1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AfilCa [17]
3 years ago
12

A client with atrial fibrillation, who does not respond to conventional treatment measures and who is not a candidate for cardio

version, would have what procedure recommended?
Biology
1 answer:
Evgesh-ka [11]3 years ago
3 0
The answer is the Maze Procedure
You might be interested in
A man with type A blood marries a woman with type B. Their offspring all have type AB blood. The pattern of inheritance is calle
Shkiper50 [21]
The answer is: a) codominance
8 0
4 years ago
Read 2 more answers
Billy put some soil into a glass jar and then planted a small green plant in the jar. He punched a few holes in the lid and then
KatRina [158]

Answer:

he covered the plant even after punching holes

Explanation:

4 0
3 years ago
Read 2 more answers
What is the definition of genes?
Alexxandr [17]
In scientific theory, genes are organisms that are transferred from a parent cell to the offspring. Overtime, it will determine some of the traits the offspring is taken from either parent.
8 0
3 years ago
During what phase of meiosis does both nuclei dissolve, spindle forms?
Vesna [10]

Answer:

Prophase I

Events of Prophase I (save for synapsis and crossing over) are similar to those in Prophase of mitosis: chromatin condenses into chromosomes, the nucleolus dissolves, nuclear membrane is disassembled, and the spindle apparatus forms. Major events in Prophase I.

7 0
3 years ago
In major cell parts what aids in cell division<br> Ex. mitochondria, ribosomes, ect.
balandron [24]
They <span>Cytoskeleton aids in cell division but its not important.</span>
6 0
3 years ago
Other questions:
  • A geologist finds a large rock containing a fern fossil. This kind of fern grew on land in hot, moist climates. What does this t
    12·2 answers
  • Someone who has been exposed to genital herpes will notice genital itching or pain about ____ to ___ days after being infected w
    12·1 answer
  • The muscles in between the ribs are called what
    14·2 answers
  • Help pls it would be nice :p
    5·2 answers
  • Name 5 illnesses caused by diseases
    13·1 answer
  • What does it mean when a molecule is said to be "polar" ?
    11·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which is a reason that bacteria can cause infections in other organisms?
    13·2 answers
  • The cells produced by meiosis are called
    13·1 answer
  • A scientist wants to test a tomato plant to see if she can make the tomato plant yield more
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!