1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
9

What’s the answer.......

Biology
1 answer:
slavikrds [6]3 years ago
8 0
B) Microscope & hand lens.

Microscope are used to see things far away, and hand lens are used to see things up close and magnify them.
You might be interested in
Living cells are continuously making a variety of proteins. This process occurs on what organelle?
stepan [7]
Riboxy Nucleic Acids or RNA
7 0
3 years ago
Read 2 more answers
In one town, some people support a proposal to
Arlecino [84]
If the people decided to build their shopping mall on the large, undeveloped lot which would build a lot of jobs and businesses this would probably also reduce the variety of the wildlife population in this area. (4). This is also the correct answer.

This would happen because building a huge project like this would affect the local wildlife population which would be forced to move to another location. 
4 0
3 years ago
Beta particles cannot penetrate very far into solids because they _____.
Bad White [126]

because they have have negligible mass            

3 0
3 years ago
PLEASE HELP ME THIS IS DUE BY 8 TONIGHT
Rainbow [258]
The answer should be 4.
7 0
3 years ago
explain how endosymbiosis is made possible due to the size difference of prokaryotes and eukaryotes.
vladimir1956 [14]
Mitochrondria of the eukaryotic cells.
<span>As many researchers hypothesize that the old single-celled organism or the origin of the complex-celled organisms came from the endosymbiosis of the mitochrondrion organism and the prokaryotic cell. It has been said that mitochondria was an independent organism which then to have been evovled itself after planting itself inside a prokaryotic cell which aided cellular respiration and production of ATP (Adenosine Triphosphate). This then aided the prokaryotic cell to be more sophisticated and caused another change from having without a true nucleus to a eukaryotic cell with a nucleus and embedded DNA. <span>
</span></span>
6 0
3 years ago
Other questions:
  • What is this thing ???
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How is the way in which carbon atoms bond to each other important for the number of carbon-based compounds?
    7·1 answer
  • Assignment: The Immune Response Exploration Classify the following as either a specific or a nonspecific defense of the body's i
    5·1 answer
  • Metamorphosis is a type of homeostasis. <br> a. True<br> b. False
    13·2 answers
  • Who tried to create a superhuman race?​
    12·2 answers
  • 45!! POINTS!! HELP PLS HELP!!
    15·1 answer
  • 4. What is a solvent?
    15·2 answers
  • Site A is pavement. Site B is bare soil. Site C is a forest, and they are all at the same slope. The percentage of rainwater tha
    5·1 answer
  • Desmosomes are made of the following cellular components
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!