1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
3 years ago
14

Which of the following correctly describes an r-strategist?

Biology
2 answers:
Goshia [24]3 years ago
7 0
Little to no care of offspring describe an r-strategist.
lutik1710 [3]3 years ago
3 0

r-strategist requires none or little care so the answer is C. Little to no care of offspring.

You might be interested in
Subunits of skeletal muscle fibers that are composed of sarcomeres are called ________. Subunits of skeletal muscle fibers that
Elanso [62]

Answer:

The correct answer is myofibrils

Explanation:

The fundamental part of the muscle cytoskeleton is made up of myofibrils that are the contractile elements of skeletal muscle cells.Muscle fibers are made up of myofibrils, membranes, and cytoskeletal networks that anchor contractile fibrils to the sarcolemma. Myofibrils are composed of repeating contractile units known as sarcomeres and are perhaps the most ordered macromolecular structures in eukaryotic cells. Myofibrils are made up of actin and myosin filaments that are large polymerized protein molecules responsible for actual muscle contraction.

4 0
3 years ago
Should existing structures build from CCA-treated wood be removed?
stiks02 [169]
<span>Chromated copper arsenate, or CCA, is a pesticide that has been used for years in pressure-treating lumber to prevent destruction from rot and insects. Arsenic, a toxic chemical, can leach from this treated wood, leaving residues on the wood’s surface and in nearby soil. Young children who play on or near decks or playscapes made from CCA- treated wood can get arsenic on their skin and into their bodies, especially if they eat or drink without washing their hands. Because of the health risks of long-term exposure to arsenic, the Environmental Protection Agency (EPA) has announced that as of December 31, 2003, arsenic Currently the EPA does not recommend that people remove existing structures made with CCA-treated wood or the soil surrounding those structures. However, they do recommend that people reduce their potential exposure to arsenic.</span>
5 0
3 years ago
Find the midpoint of the line segment joining the points ​(-4​,-1​) and ​(​-6,10​).
nekit [7.7K]

Answer:

hkafb I have to go to a meeting

5 0
4 years ago
Which of these is a renewable resource humans depend on? A) crude oil. B) Fertile soil. C) Natural gas. D) fossil fuel
Wittaler [7]

Answer:

fertile soil is the renewable source

3 0
2 years ago
A force is a push or pull that is described by its
k0ka [10]

I would think that it is B or C

7 0
3 years ago
Other questions:
  • Skin color, fur color, and height are examples of which inheritance pattern?
    10·2 answers
  • Which of the following best describes how a blood cell and skin cell have the exact same DNA sequence and yet
    6·1 answer
  • The climate in the Siberian tundra
    11·2 answers
  • (04.02 LC) SOMBODY HELP PLEASE THANKS :D
    13·1 answer
  • How does a cell avoid DNA overload ?
    5·1 answer
  • Which of the following are characteristics of primates? Check all of the boxes that apply.
    9·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • In the homeostasis lab we are using ____________________ as a homeostatic parameter.
    11·1 answer
  • Which type of plant tissue contains open vessels that transport water, irons, materials and nutrients throughout a plant
    6·1 answer
  • To remember abdominal muscles, explain what TIRE stand for the phrase “spare TIRE”.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!