1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
3 years ago
11

A person's skin cells and eye cells make different types of proteins to perform their functions. What is the source of the instr

uctions from which all of the proteins are made?
(A) Genes
(B) Mitochondria
(C) Ribosomes
(D) Gametes
Biology
2 answers:
Dafna1 [17]3 years ago
7 0

Yea, its C , ribsomes I am pretty sure

saul85 [17]3 years ago
4 0
The proteins are made in the cell's ribosomes
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Sliding a box across the floor.....Desirable or not desirable friction??
True [87]
Isnt it not desirable? you dont want friction to act when you push a box

7 0
3 years ago
What do the data suggest about the effects of cane toads on the predatory behavior of black snakes in areas where the toads have
Brrunno [24]

Answer: C. Black snakes will not prey on cane toads in areas where cane toads have been present for 40–60 years.

Explanation:

Cane toad secret a toxin called bufotoxin which is a defense mechanism against predators. These defense mechanism is capable of killing black snakes if they eat cane toads. Within a period of 40 to 60 years, the black snakes in these area will be aware of the presence of a toxin capable of killing them in cane toads and will not prey on them. This phenomenon is termed learned behavioral adaptation.

4 0
3 years ago
Hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
Firlakuza [10]

hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

4 0
3 years ago
Read 2 more answers
A plant stores 3000 Joules of energy into an apple. If a pig eats the apple, then a human eats the pig, how much of the apple’s
san4es73 [151]
A.3000 joules on eng that’s what it is
6 0
3 years ago
Other questions:
  • Bruce has a genetic disorder. bruce and his wife, kim, have three children, one of which has the genetic disorder. how is this d
    8·1 answer
  • En un cruzamiento entre plantas de guisante homocigoto con semillas amarillas redondas (YYRR) y plantas de guisantes homocigoto
    8·1 answer
  • Facts and figures are examples fo variable true or false
    11·1 answer
  • How do ants use formic acid to stay alive?
    5·1 answer
  • Why must the use of pesticides be carefully controlled?
    11·2 answers
  • Which are the only invertebrates that can fly?
    8·2 answers
  • What is the definition of primate?
    9·1 answer
  • What is the area of the triangle?<br> 16<br> 10<br> 8
    11·1 answer
  • How is the small ribosomal unit positioned to allow for translation to start at the proper start codon
    6·1 answer
  • CER:Are viruses living thing?​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!