1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
4 years ago
15

Which of the following best explains why the sequence of amino acids affects a protein's shape?

Biology
2 answers:
antoniya [11.8K]4 years ago
8 0

Answer:

I think the right answer is the first one, the  boining with a protein depends on the sequence of amino acids. And if you have some other question zbout animo acids or protein sequencing, the link may help a lot. protein sequencing source: <u>https://www.creative-proteomics.com/services/sequence-analysis-of-peptides-or-proteins.htm</u>

Explanation:

vova2212 [387]4 years ago
4 0

I believe it is:

the bonding within a protein depends on the sequence of amino acids

Because proteins have multiple structures whether it is primary, secondary, tertiary, etc.,  and they vary based on the bonds such as dipeptide.

You might be interested in
Hormones are _____. see concept 45.1 (page 998) signals that must interact with dna in order to be effective always proteins pro
DENIUS [597]
<span><span>The answer is ‘transported in blood or hemolymph are all under the control of the pituitary gland’. The pituitary is the master gland because it controls functions of other endocrine glands that produce different hormones.</span> <span>Hormones allow communication between organs and tissues for physiological regulation and behavioral activities, such as digestion, metabolism, respiration, and tissue function. </span></span>




4 0
3 years ago
Energy that is stored energy that is ready to be used A. Chemical B. Thermal C. Potential D. Kinetic
ycow [4]
Energy that is stored is Potential energy.
8 0
3 years ago
Females of many insect species, including honeybee queens, can store gametes shed by their mating partners in _______. A. their
Anit [1.1K]

In the spermatheca, females of many insect species, including honeybee queens, can store gametes secreted by their sex partners.

<h3>What is Spermatheca ?</h3>

The female insect's spermatheca is an ectodermal structure that receives, stores, and releases sperm for egg fertilization. According to the species, spermathecae differ in size and shape.

  • They often come from the median oviduct, which is located close or on the genital chamber. A secretory duct called the ductus seminalis connects the spermathecal sac, also known as the receptaculum seminis, to the genital chamber, where the sperm are released.
  • The number of spermathecas varies among taxa, however the majority of insects only have one. Depending on the species of insect, the spermatheca has different morphologies. The spermatheca is composed of the spermathecal gland, duct, and reservoir. Both of these fluids feed the sperm. Both the spermathecal glands and the male accessory glands secrete substances that feed the sperm.

So lastly we can say that, t females of many insect species, including honeybee queens, can store gametes shed by their mating partners in - the spermatheca.

To know more about Spermatheca please click here : brainly.com/question/9748392

#SPJ4

3 0
2 years ago
what is the meaning of phosphoryl transfer potential and what does it mean to have a high or low phosphoryl transfer potential?
makvit [3.9K]

Phosphoryl-transfer potential is the ability of an organic molecule to transfer its terminal phosphoryl group to water which is an acceptor molecule. It is the “standard free energy of hydrolysis”.

Explanation:

This potential plays a key role during cellular energy transformation by energy coupling during ATP hydrolysis.  

A compound with a high phosphoryl-transfer potential has the increased ability to couple the carbon oxidation with ATP synthesis and can accelerate cellular energy transformation.  

A compound with a high phosphoryl-transfer potential can readily donate its terminal phosphate group; whereas, a compound with a low has a lesser ability to donate its phosphate group.

ATP molecules have a high phosphoryl transfer potential due to its structure, resonance stabilization, high entropy, electrostatic repulsion and stabilization by hydration. Compounds like creatine phosphate, phosphoenolpyruvate also have high phosphoryl-transfer potential.

8 0
3 years ago
A solution contains the same number of hydronium ions as hydroxide ions. Is the solution acidic, basic or neutral? What is the p
Nikolay [14]
If a solution has equal hydronium and hydroxide ions, the solution is considered neutral. A neutral pH is 7.
6 0
3 years ago
Other questions:
  • What can you assume about the amount of glucose (sugar) that is produced as you move the light closer? Would it go up or down?
    12·1 answer
  • Difference between glottis and gullet
    15·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • The cyanobacteria reproduce by simple cell division known as _____. fission fusion germination
    12·2 answers
  • In what condition to falling leaves the key the fastest?
    14·1 answer
  • Explain how an ace inhibitor might have helped anna mediate blood pressure
    6·1 answer
  • Why cant chloroplasts and mitochondria live outside the cell now?
    11·1 answer
  • 3. Organisms that are NOT autotrophs
    7·1 answer
  • A student made a model of a eukaryotic cell using the resealable plastic bag shown. She placed a golf ball inside the bag.
    11·1 answer
  • What skills and education do careers in agronomy require?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!