1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
3 years ago
11

what is the meaning of phosphoryl transfer potential and what does it mean to have a high or low phosphoryl transfer potential?

Biology
1 answer:
makvit [3.9K]3 years ago
8 0

Phosphoryl-transfer potential is the ability of an organic molecule to transfer its terminal phosphoryl group to water which is an acceptor molecule. It is the “standard free energy of hydrolysis”.

Explanation:

This potential plays a key role during cellular energy transformation by energy coupling during ATP hydrolysis.  

A compound with a high phosphoryl-transfer potential has the increased ability to couple the carbon oxidation with ATP synthesis and can accelerate cellular energy transformation.  

A compound with a high phosphoryl-transfer potential can readily donate its terminal phosphate group; whereas, a compound with a low has a lesser ability to donate its phosphate group.

ATP molecules have a high phosphoryl transfer potential due to its structure, resonance stabilization, high entropy, electrostatic repulsion and stabilization by hydration. Compounds like creatine phosphate, phosphoenolpyruvate also have high phosphoryl-transfer potential.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Jerome puts two magnetic vehicles very close to each other. what will happen next, and why?
vekshin1
The magnetic vehicles will move closer to each other because the magnetic force will pull the vehicles together.
8 0
3 years ago
Scientists have evidence that meteorites have come from which option of locations?
Step2247 [10]

Mars and Moon are the locations from which meteorites would come.

Option (c);

<u>EXPLANATION: </u>

  • The meteorites found on Earth look like martian crystal rocks.
  • These might be first ejected into space during a collision of an asteroidal object with Moon or Mars and then it got into the Earth orbit because of the force produced during the collision.
  • There are around seventy meteorites recognised to have come from the planet Mars till up to the present date.
  • There are three types of meteorites such as Martian meteorites and a sample of two lunar meteorites.
  • To identify the origin of the meteorite, the scientist tries to identify the type of rock followed by analysing the chemical composition and then try to identify its age.
8 0
3 years ago
Hellllllllllppppp pleasse!!!!!!!
LekaFEV [45]

Answer:

Im not sure but I think its a

Explanation:

I learned it in class

4 0
3 years ago
Read 2 more answers
How many chambers does the heart contain?<br> A. 3 <br> B. 4 <br> C. 5 <br> D. 6
Wittaler [7]
<span>The heart contains four chambers: upper left atria, upper right atria, lower left ventricle and the lower right ventricle. Oftentimes, the right atria and right ventricle are together referred to as the "right heart" and the left atria and left ventricle are referred to as the "left heart", however there are still four separate chambers.</span>
4 0
4 years ago
Read 2 more answers
Other questions:
  • The fitness boom is most prominent in lower socioeconomic categories. question 15 options: 1) true 2) false
    15·1 answer
  • HELP ASAP PLEASE!!<br><br> A ___is a prediction based on data and information you researched.
    6·1 answer
  • How does a catalyst influence a chemical reaction?
    13·2 answers
  • Pain signals often have two components: an acute sensation of "first pain" which is felt almost immediately after an injury, and
    9·1 answer
  • Why are stem cells important?
    7·1 answer
  • The most crucial factor determining the resting potential of a neuron is the diffusion of
    14·1 answer
  • What role does the nitrogen cycle play in the life cycle of a plant? ( please help me! thank you! )
    11·2 answers
  • In an experiment to investigate a factor affecting photosynthesis, a leaf of a potted plant which had been kept in the dark over
    6·1 answer
  • Choose All that apply !! <br> Help!!
    6·1 answer
  • Is oxygen bubbles/gas reactant or product?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!