1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VashaNatasha [74]
3 years ago
6

Which of the following structures or systems is correctly paired with its function? (2 points)

Biology
1 answer:
krok68 [10]3 years ago
4 0

Answer:

central nervous system

Explanation:

The central nervous system is made up of the brain and spinal cord which carry out the function of processing information about the environment using the five senses and sends out your bodies response. such as if your finger touched the hot stove, that signal gets sent to your brain which sends a signal to your spinal cord telling your arm to pull away from the hot surface

You might be interested in
What of the following correctly identifies some of the molecules produced from the glucose synthesised by photosynthesis?
Yuliya22 [10]

Answer:

plant life use a system known as photosynthesis to make meals.

at some stage in photosynthesis, plant life entice mild strength with their leaves.

plant life use the strength of the solar to extrade water and carbon dioxide right into a sugar known as glucose.

glucose is utilized by plant life for strength and make different materials like cellulose and starch.

cellulose is utilized in constructing mobileular walls. starch is saved in seeds and different plant components as a meals source.

Explanation:

5 0
2 years ago
Determine why people who have had cholera or been vaccinated do not have immunity.
shtirl [24]
The cholera bactery evolves which means it changes the way it works. So if you are vaccinated, the bactery will evolve itself in such a way that your body doesn't reject it.
8 0
3 years ago
Why do scientists use models to study changes to the earth’s surface
Stells [14]
Because it’s time consuming and money consuming to observe from space so models are required
6 0
3 years ago
What happens after mRNA<br> leaves the nucleus?
belka [17]

Answer: It goes to the ribosome for translation to occur. The ribosome is located in the cytoplasm.

6 0
2 years ago
On Christmas morning, 3-year-old Billy opens a gift from his mother and finds a new sweater. Disappointed that it is not a toy,
maw [93]

Answer: egocentric thought

Explanation:

he is only thinking of his self

7 0
3 years ago
Other questions:
  • Muscles help to move different parts of our body. The part that moves
    15·1 answer
  • Why do organisms found at low temperature have membrane proteins with a higher percentage of alpha helices compare to beta sheet
    10·1 answer
  • 3. Funaria is a bryophyte because
    5·1 answer
  • A biology class wanted to study the effect of different materials on the melting rate of ice. They placed pieces of ice, each wi
    10·2 answers
  • which program created during g president Johnsons administration focuses on providing health coverage to elderly
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Humans take in the energy they need to survive through which body parts
    12·1 answer
  • Radio waves, infrared waves, visible light, and Xrays are all forms of energy
    6·1 answer
  • Please help<br><br><br>me with this​
    15·1 answer
  • The best example of an animal phylum with enhanced overall surface area is _____.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!