When glucose is high, cAMP is low; CAP does not bind the lac operator, and RNA polymerase does not bind the lac promoter. CAP is only active when glucose levels are low, which means the cAMP levels are high, and therefore the lac operon can only be transcribed at high rate when glucose is absent. The importance of this is that the bacteria only turns on the lac operon and start using lactose only after they have used up all the preferred energy source which is glucose.
Answer:
correct answer would be B, Fewer sugars will be produced.
Explanation: :}
Answer:
:-) maintaining the pH of the reaction at 6.7
Explanation:
hope this helps
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.