1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
3 years ago
15

Which of the plants would likely be the first to colonize a newly formed volcanic island (an environment of bare rock with no de

veloped soil)? A. lycophytes B.gymnosperms C.vascular plants D.bryophytes
Biology
1 answer:
xxTIMURxx [149]3 years ago
5 0

Answer:

D. Bryophytes

Explanation:

They are usually the first colonizers. Their root system which aren't true roots, called Rhizoids help attach them to Rocky surface.

You might be interested in
When glucose is high, camp is _____ : cap _____ bind the lac operator, and rna polymerase _____ bind the lac promoter. high; doe
mote1985 [20]
When glucose is high, cAMP is low; CAP does not bind the lac operator, and RNA polymerase does not bind the lac promoter. CAP is only active when glucose levels are low, which means the cAMP levels are high, and therefore the lac operon can only be transcribed at high rate when glucose is absent.  The importance of this is that the bacteria only turns on the lac operon and start using lactose only after they have used up all the preferred energy source which is glucose. 
6 0
3 years ago
Read 2 more answers
Please hurry!!!
Papessa [141]

Answer:

correct answer would be B, Fewer sugars will be produced.      

Explanation:   :}

3 0
3 years ago
Salivary amylase is an enzyme that breaks down starch. The optimum or best pH for this reaction is 6.7. Which of the following w
zzz [600]

Answer:

:-) maintaining the pH of the reaction at 6.7

Explanation:

hope this helps

7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Uring DNA replication, what would be the complementary strand to the original DNA segment of GCTAAT?
S_A_V [24]

CGATTA is the answer.

8 0
3 years ago
Other questions:
  • In photosynthesis, what gives energy to the electron moving through the electron transport chain?
    14·2 answers
  • When a substance or large molecule is enclosed by a membrane in a vesicle within the cell, the membrane of the vesicle fuses wit
    14·1 answer
  • BRAINLIEST TO WHOEVER ANSWERS THIS QUESTION CORRECTLY
    5·2 answers
  • The nutritional energy content (in Calories) present in 86g of broccoli with 2.6g of protein, 6g of carbohydrates, and 0.3g of f
    12·1 answer
  • You sample a population of butterflies and find that 42% are heterozygous at a particular locus. assuming hardy-weinberg equilib
    8·1 answer
  • 1. When did fires first show up in Yellowstone's history and how often did they occur each year on
    8·1 answer
  • a spaceship is designed to support animal life for a multiyear voyage to the outer planets of the solar system. plants will be g
    10·1 answer
  • What is an indirect measure of the amount of energy released from food?​ a. ​The increase in heat given off when the food is bur
    13·1 answer
  • What is the limitations of classifying organisms by appearance
    14·1 answer
  • Please help would be very much appreciated​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!