1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
7

Explain how scientific discoveries in biotechnology have improved people's lives

Biology
2 answers:
aksik [14]3 years ago
6 0

Aspects such as genetic engineering have allowed for engineering of transgenic organisms such as bacteria to produce bioproducts such as insulin to addresses medical disorders such as diabetes.  Another is the innovation of whole-genome sequencing that allows researchers to determine genetic predisposition of a particular person to particular diseases.






Butoxors [25]3 years ago
6 0
Scientific discoveries in biotechnology have improved people's lives in a number of ways; It can be used to find cures and treatments for disease, to test for genetic issues, and to produce helpful drugs. Techniques can also be used for agriculture, including the creation of hardier and more nutritious crops. 
You might be interested in
Coral reefs are sometimes referred to as the rainforests of the ocean because of their high levels of biodiversity. Please selec
Dominik [7]

Answer:

<em>The above statement is true.</em>

Explanation:

Coral reefs can be described as a population of corals which exist in underground water usually. The reefs are formed by the accumulation of the coral polyps.

The coral reefs are rich in life and are hence known to be the tropical rain forests of the sea. The coral reef have high levels of biodiversity and also help out in various ecological processes. They are well known for holding the most diversified ecosystem on the planet Earth.

4 0
3 years ago
Read 2 more answers
I need help, Help me pls :(
Karolina [17]

Answer:

Can you send the article?

5 0
3 years ago
What part of the universe do we live in??
vichka [17]
We live in part of the Milky Way galaxy which is part of the universe. There are countless other galaxies out there besides the Milky Way
5 0
3 years ago
______are reactants in the process of cell respiration
Evgen [1.6K]

Answer:

The reactants are the Products of Photosynthesis which is glucose and oxygen.

C_{6}H_{12}O_{6}+60_{2}

Explanation:

4 0
4 years ago
Read 2 more answers
Which of the following molecules is NOT a polymer?
Aleonysh [2.5K]

Answer:

B. Glucose

Explanation:

Glucose is a monomer

3 0
3 years ago
Other questions:
  • Not all areas on Earth's surface receive the same amount of radiation because Earth's surface ____. a. is flat c. has continents
    5·2 answers
  • What characteristics of a northwest coniferous forest biome make it an appropriate home for banana slugs
    7·1 answer
  • What is a common site for bone metastases to occur? vertebral bodies midshaft femur carpal bones radius?
    9·2 answers
  • Biological diversity is the greatest in which biome?
    10·1 answer
  • What is the stamen of a flower
    7·2 answers
  • Why dose pressure change inside of earth​
    13·1 answer
  • I need some help please!
    14·1 answer
  • Which point(s) in the water cycle below best illustrate(s) water changing to a gas, and which term(s) could describe it? 1; subl
    12·2 answers
  • Plants can reproduce both sexually and asexually. Asexual reproduction does not require the investment required to produce a
    12·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!