What do you need help with sir??
Answer:
Shadows are made by blocking light. Light rays travel from a source in straight lines. If an opaque (solid) object gets in the way, it stops light rays from traveling through it. This results in an area of darkness appearing behind the object. The dark area is called a shadow
Any photos below 7 is known as acidic, the lower the pH the more acidic the solution I believe.
I don’t really understand the question but i’m assuming that’s there’s a chemical reaction happening when the bicyclist is eating the food to get energy to bike?
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
