Answer:
Brown is the dominant gene and white is the recessive gene.
Explanation:
If brown were to be dominant then the mice would most likely all be brown unless the got both a white from mom and dad which is most likely due to brown being recessive the dad could be part white you just wouldn't see it. And since the mother is white all of the mice get a white gene from the mom and since the dad most likely has a white gene hidden inside of him only tow mice became fully white while the siblings were brown.
Hope this helps.
bc the more the earth tilts the farther away that part of the earth gets from the sun so therefor its not goin to be as hot over there
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
The correct answer is- B) Cell walls are made primarily of peptidoglycan
Explanation:
There is a difference between the cell wall of bacteria, archaea, and eukarya. The cell wall of bacteria is primarily made up of peptidoglycan which contains two sugar N-acetylglucosamine and N-acetylmuramic acid while archaea contain two N-acetyltalosaminuronic acid (NAT) in place of N-acetylmuramic acid which is called pseudo-peptidoglycan.
Eukaryotic cell wall is also different from archaeal and bacterial cell wall and animals in eukaryotes do not have a cell wall. Therefore cell wall made up primarily of peptidoglycan will allow you to classify the organism as belonging to Bacteria but not Archaea or Eukarya.
