Answer:
pointing up labeled 3 N, an arrow pointing right labeled 2 N, an arrow pointing
Explanation:
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
For him they were just discrete physical units of inheritance. Johanson coined the term "gene" and people started calling them genes. Today for us these factors are parts of DNA, the base sequences that carry the biological information to determine a trait. Mendel factors are alleles of genes.
