1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
3 years ago
9

Which of the following causes ozone depletion?

Biology
2 answers:
madam [21]3 years ago
5 0

<em>Answer:</em>

<em>Hello There. The correct answer is </em>C. <em>excessive carbon dioxide blanketing the Earth.</em>

Explanation:

Because it means that Carbon dioxide spreads around the planet like a blanket, and is one of the main gases responsible for the absorption of infrared radiation (felt as heat), which comprises the bulk of solar energy. Hope It Helps! .ω.

DedPeter [7]3 years ago
3 0

Answer:

B. foaming agents or plastics releasing chloroflourocarbons

Explanation:

Causes : chlorofluorocarbon (CFCs), halons, and other compounds deplete the ozone layer. These chemicals are found in cleaning agents, aerosols, insulating foam, and refrigerants. CFCs and halons break down into chlorine and bromine which in turn destroy the ozone layer.

You might be interested in
Ritika observes that her father before storing the grains always dries them
Lunna [17]
D so that bacteria doesnt multiply in the grains since moisture favours them
7 0
2 years ago
Read 2 more answers
Which statement indicates what the fossil record
nexus9112 [7]

Answer:the first one

Explanation:

5 0
3 years ago
Read 2 more answers
Wie atmet der Regenwurm?
zlopas [31]

Answer:

.

Explanation:

3 0
3 years ago
Read 2 more answers
Bill Nye Science guy genes answers help plz
hram777 [196]

Answer:

I need the whole page

Explanation:

5 0
3 years ago
Read 2 more answers
22) Using x-ray crystallography, as well as other methods, the researchers Watson and Crick discovered the ________________ stru
seraphim [82]
Double-helix. Hope it helps! 
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the tendency of an object to resist a change in its motion?
    10·2 answers
  • *<br> Ribosomes - What do ribosomes make?<br> -Cytoplasm<br> -Other organelles<br> -Proteins
    13·1 answer
  • Which statement is an example of a scientific theory? I NEED HELP
    7·1 answer
  • 25. Review the graph below. Blue Jays and Robins do not interbreed. Assuming that both birds live in the same habitat, what woul
    14·1 answer
  • What type of fossil fuel is made from trees ferns Moss is and other marsh plants
    10·2 answers
  • Which describes the current human population growth?
    14·1 answer
  • For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • During the Devonian period of Gondwanaland what were the two organisms that thrived?
    6·1 answer
  • The primary purpose of which human organ system is to produce hormones that regulate body functions?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!