the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'
the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand
so for reference heres a little cheat guide
Adenine=Thymine
Thymine=Adenine
Guanine=Cytosine
Cytosine=Guanine
Photosynthesis is a process mechanism in plants<3
Answer:
The correct answer is c. Fatty acids
Explanation:
There are four major types of macromolecules present in nature and that are carbohydrates(polysaccharides), proteins, lipids, and nucleic acids. These macromolecules are polymers and are made up of monomer units.
The monomeric unit of polysaccharides is mainly glucose, of protein is amino acids, of nucleic acid is nucleotides and the monomeric unit of lipid is fatty acids. Ribosomes are macromolecules because it is made up of RNA and proteins.
So fatty acid is a monomer which joins together to form large macromolecules like lipids. Fatty acids are made up of a hydrocarbon chain which have one attached COOH group at the terminal position.
Therefore the correct answer is c. Fatty acids.
Answer:
it is increasing it because it is pushing animals out of their ecosystem and destroying their food sources and homes.
Explanation:
