1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
3 years ago
12

A client is hospitalized with posterior nasal bleeding and has a gauze pack in the posterior nasal cavity. the nurse assesses th

e client and notes restlessness and anxiety and an oxygen saturation of 92%. which initial action by the nurse is correct? 1
Biology
1 answer:
max2010maxim [7]3 years ago
6 0
<span>The best initial step would be to try calming the patient down. Since the patient is restless and anxious, he or she may be hyperventilating and therefore, blowing out too much CO2. The nurse should tell the patient to take nice, deep breaths through the mouth, and if necessary, have the patient breath into a brown paper bag to restore the acid/base imbalance.</span>
You might be interested in
Any three cause and effect of enviroment pollution​
natulia [17]

Answer:

<h2>Additionally, environmental pollution is triggered by the introduction of harmful materials, such as gaseous pollutants, toxic metals, and particulate matter (PM) into the atmosphere; sewage, industrial effluents, agricultural runoffs, and electronic wastes into water bodies; and activities such as mining, ...</h2>

4 0
2 years ago
Endosymbiosis of cyanobacteria is widely accepted as an explanation for the development of chloroplasts. The presence of endosym
lilavasa [31]

Answer:

The correct answer is- photosynthesis

Explanation:

According to the endosymbiotic theory, an ancestral cell engulfed a cyanobacteria and lived in symbiotic association with that bacteria and over time this bacteria evolved into the chloroplast and the ancestral cell developed into plant cell.

So as cyanobacteria was the first aerobic cell that can evolve oxygen and can do photosynthesis to produce organic food so it could be concluded that the presence of endosymbiotic cyanobacteria provided a cell with the advantage of photosynthesis.

3 0
3 years ago
Why is it important to study cells
evablogger [386]
Because cells are in ever living thing

8 0
3 years ago
Which is an example of how the cell membrane of a tube worm maintains a
Nikitich [7]

Answer:

c

Explanation: this is the correct answer

4 0
3 years ago
Read 2 more answers
Which substances in the stimulation have particles that are atoms only
otez555 [7]
In the simulation, neon and argon have particles that are single atoms. On the other hand, each particle of oxygen is made of two atoms of the same kind. Hope this helps
4 0
3 years ago
Other questions:
  • A fossil is found to have a 14c level of 67.0% compared to living organisms. how old is the fossil?
    11·1 answer
  • Where are the following fluids found:
    10·1 answer
  • Which body type has a stocky build and tends to gain both muscle mass and body fat easier than other body types?
    9·1 answer
  • What is the y-axis of this chart
    8·1 answer
  • How do older female killer whales help their family​
    13·1 answer
  • Which type of epithelium is composed of multiple layers, including an apical layer containing tall, slender cells?
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • According to the ideas of Thomas malhus what are the predicted changes to the human population after 2050
    6·1 answer
  • Based on the DNA strand here, what is the contemporary: 5’- ACTGACATG -‘3
    12·2 answers
  • Define the five systems. Be sure to include enough information to distinguish each system from the others.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!