1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
3 years ago
12

Which of the following processes make a sweat when I exercise

Biology
1 answer:
Dima020 [189]3 years ago
7 0

Answer:

Homeostasis

Explanation:

Homeostasis is an organism ability to maintain equilibrium [which means balancing opposing forces]. When we sweat our body it is trying to stop overheating.

You might be interested in
Which best explains how coal deposits formed?
lorasvet [3.4K]

Answer:

D

Explanation:

8 0
3 years ago
According to the bar graph, how many players
ivanzaharov [21]

Answer: 1

Explanation: because that the bar graph that goes. higher then 30

8 0
3 years ago
Does a steep curve on a line graph indicate a rapid or slow rate of change​
MaRussiya [10]
Generally speaking if time is on the x-axis and the thing that’s changing is on the y-axis, a steep curve would indicate a rapid rate of change.
4 0
3 years ago
How did the carbon atom get into cellular respiration
Pepsi [2]

Carbon atoms are converted into metabolites like acetic acid, lactic acid, aldehydes, etc via the action of different bacteria. In the process of fermentation or cellular respiration, carbon atoms are cleaved into three carbon molecule called pyruvate then eventually forming into metabolites.

4 0
3 years ago
Read 2 more answers
Too much insulin, too little or delayed food, exercise, alcohol, or a combination of these factors can lead to ________.
strojnjashka [21]
Can lead to diabetes
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In the food chain, the grasshopper would be classified as a?
    15·2 answers
  • Which characteristic do most adult fungi and plants share? A- they're both producers  B- both have cells with cell walls   C- Bo
    10·2 answers
  • In which group do the rocks usually have the mineral quartz as part of their composition
    6·2 answers
  • A human sperm cell has Select one:
    8·2 answers
  • The organelles that produce proteins used within the cell are the _____.
    6·2 answers
  • Plz help help help help
    14·1 answer
  • Which is more infectious DNA VIRUS OR RNA VIRUS??<br><br>EXPLAIN​
    5·1 answer
  • What process do pondweeds carry out in the presence of light?
    9·1 answer
  • ____________ is often criticized by both heterosexuals and lesbian/gay individuals as indicating promiscuity, indecisiveness, or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!