1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
3 years ago
7

What is the ratio 15/45 expressed in simplest form?

Mathematics
1 answer:
DiKsa [7]3 years ago
3 0
<span>To find the simplest form of a fraction, you have to find the greatest common factor (GCF). To do so, list out the factors of the numerator (15) and the denominator (45) and find the biggest common number between the two numbers.
</span>
Factors of 15: 1, 3, 5, 15
Factors of 45:  1, 3, 5, 9, 15, 45

Out of those factors, we can see that 1, 3, 5, and 15 are the common factors, but 15 is the greatest which makes it our GCF. 

Now we can divide the numerator and the denominator by the GCF to receive our simplest form.

15 ÷ 15 = 1
45 ÷ 15 = 3

Rewrite the fraction with the new numerator (1) and the new denominator (3).

The simplest form of 15/45 is: 1/3 or 0.3333.
You might be interested in
The advertised claim for batteries for cell phones is set at 48 operating hours with proper charging procedures. A study of 5000
Komok [63]
Yes cghhfdghgdfggfffdgghhg
8 0
3 years ago
What’s the slope of (5,3) and (10,8)
AlekseyPX

The slope of this ordered pair is 1.

8 0
3 years ago
Help me with this lol value of( 2^3)^2
ss7ja [257]

Answer:

64

Step-by-step explanation:

first, we'll start with the value inside the parenthesis, which is 2³

2³ means to multiply 2 by itself 3 times

so it would be

2×2×2=8

which then means that the expression is now (8)²

now we need to do (8)², which is to multiply 8 by itself twice

8*8=64

hope this helps!

6 0
3 years ago
Helppp quick! That’s the question^ please help guysss
Digiron [165]

Answer:

The slope represents the cost per gallon for heating oil while the y-intercept represents the fee for heating oil.

4 0
3 years ago
What is the mean of the following set?<br><br> 34, 31, 32, 38
larisa [96]

Answer:

33.75.

Step-by-step explanation:

The mean = sum of the numbers / the number count

= (34 + 31 + 32 +  38) / 4

= 135 / 4

= 33.75.

7 0
3 years ago
Other questions:
  • What is the degree of the power function represented in the table?
    13·1 answer
  • How to understand math​
    11·1 answer
  • PLEASE ANSWER I NEED HELP!!..
    8·1 answer
  • Paul spent $36.52 at a clothing store. He gave the cashier $40.02. How can the cashier give him the correct change with the
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How do you find the width of a number when you have the feet and total area
    15·2 answers
  • Which is the best sale?
    15·2 answers
  • Nadia is ordering cheesecake at a restaurant, and the server tells her that she can have up to five toppings: caramel, whipped c
    10·2 answers
  • Find the value of<br> x for which ABCD<br> must be a<br> parallelogram.<br> 24<br> 2<br> 6<br> 12
    10·2 answers
  • I don’t understand HELP ME PLEASEEEEEE!<br> !
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!