Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Consequences of the widespread use of plastic materials can be an increase in levels pollution and the overflowing of landfills because most plastics are non-biodegradable and can take a very long time to disappear unlike things like paper which are biodegradable.
100% Aa because each have a dominate A and a dominate a meaning they are exactly alike
Lactose tolerance and intolerance together with other northern European individuals Lactose, the sugar found in dairy items and drain, is processed by the catalyst lactase.
Lactose intolerance is a typical stomach related issue where the body can't process lactose, a sort of sugar mostly found in drain and dairy items. Manifestations of lactose intolerance, as a rule, create a couple of hours of devouring nourishment or drink that contains lactose.
ATP stands for andensoine triphosphate
It is the energy currency of the cell because it is used to store energy in the body
