1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ololo11 [35]
4 years ago
11

What is a reason why viruses could be considered abiotic and biotic?

Biology
1 answer:
Margaret [11]4 years ago
3 0
One can consider viruses abiotic is the fact that they can be quite mobile as well as also containing genetic material.

They are abiotic however because they do not use energy, and have no involvement in organic processes, merely being sacs of genetic material.
You might be interested in
What connects the two hemispheres of the brain?
Len [333]
The structure that holds the two hemispheres of the brain is the corpus callosum.
4 0
3 years ago
How can the luster of a mineral be described?
balandron [24]

Answer:

c. dull

Explanation:

5 0
3 years ago
Read 2 more answers
____________ is a network of specialized cells that monitors the internal and external environment and initiates commands throug
Nutka1998 [239]
<span>Nervous system is a network of specialized cells that monitors the internal and external environment and initiates commands through which the body reacts.

Nervous system is very important part of our body because it is the system which is controlling our body. If there is no nervous system we could not perform any function. It sends the message to and from the brain to all parts of body.</span>
6 0
3 years ago
Nucleotides in rna are connected to one another in the polynucleotide chain by
Gre4nikov [31]

not sure what you mean, but I think you're talking about the bonds i suppose. Anti-parallel strands are connected by H-bonds, whereas the sugar and phosphorus are bonded by covalent phosphodiester bonds.

3 0
3 years ago
Janelle made a hypothesis about the uneven temperatures inside her house during winter. She believes that 50% of the heating duc
balu736 [363]
If Janelle wants to prove her hypothesis using the scientific process, what she should do next is to run an experiment because once the individual has undergone to a scientific process and she has stated her hypothesis, the individual should start running her experiment in means of testing her hypothesis that will help her in distinguishing whether her hypothesis is correct or not.
5 0
4 years ago
Read 2 more answers
Other questions:
  • Which process is performed by both plants and animals to break down sugars to provide energy in the form of atp
    13·1 answer
  • What stimulates the secretion of erythropoietin
    7·1 answer
  • Difference of blood between a healthy person and a patient with leukemia.<br>​
    8·1 answer
  • Closed systems do not interact at all with other systems.
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which type of bond is found in many carbon-to-carbon bonds in canola oil, but very few carbon-to-carbon bonds in butter?
    5·2 answers
  • Which statement best describes an ecological benefit of marshes?
    8·1 answer
  • Why are viruses at the border line of being living or non living?​
    12·1 answer
  • 7. What is a blastocyst? There are two “groups” of cells that make up the blastocyst. What will each of
    6·1 answer
  • With reference to the induced fit model, describe how the tertiary structure of a named enzyme facilitates its function as a bio
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!