1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
5

How does gas exchange occurs when the circulatory and respiratory systems work together

Biology
2 answers:
tino4ka555 [31]3 years ago
8 0

The circulatory system helps to pump blood throughout the body. This is important because red blood cells work to carry oxygen throughout the body. The respiratory system is what allows us to breathe in this oxygen that is later absorbed by red blood cells. The respiratory system also extracts carbon dioxide from the blood which we later breathe out.

Ahat [919]3 years ago
4 0

The respiratory and circulatory systems work with each other in this manner, the respiratory system will obtain oxygen then the circulatory system brings the oxygen to different parts of the body then it also takes carbon dioxide from  different tissues of the body and bring carbon dioxide to lungs then the respiratory system takes carbon dioxide outside the body during exhalation



You might be interested in
Photosynthesis is the main method by which primary production takes place in an ecosystem. What abiotic factor is a beneficial b
iris [78.8K]

Oxygen is an abiotic factor that is beneficial by-product of primary production.

<u>Explanation:</u>

The non living parts of an ecosystem that mainly affects the living organisms in it are called as an abiotic factor. These can include soil, temperature, water, oxygen and sunlight. The major energy source in earth is Oxygen which is abiotic factor.

It is very essential for the photosynthesis process to take place. Here, the plants converts water and carbon dioxide into oxygen and sugar. This becomes food for plants. Then these plants are eaten by animals. Thus oxygen is an important and beneficial by-product of photosynthesis. Oxygen is also very important for the survival of human beings.

5 0
3 years ago
Read 2 more answers
What is genetically modified food?
dmitriy555 [2]
<span>genetically modified food is food the has add ins

</span>
3 0
3 years ago
Read 2 more answers
Story: Blue green algae are a kind of bacteria found in many lakes. These organisms make their own food through photosynthesis.
Gre4nikov [31]

Explanation:

then this is a good idea to have a great day and address of the topic of your name and address of the topic of your name and address of the topic of your name and address of the topic of your name and address of the topic of your name and address of

7 0
3 years ago
Read 2 more answers
A costumer wants to buy a 1:1 mixture of blue and red beans. Each blue bean is twice as massive as each red bean. If the clerk m
Paladinen [302]

2.5 kilsos because if you double that it goes to 5 kiilos.

5 0
3 years ago
What scientist is credited with the idea of evolution via natural selection
vovikov84 [41]
Charlee Darwin <span>t is credited with the idea of evolution and the theory natural selection.</span>
8 0
3 years ago
Other questions:
  • Read the following statements that describe how information flows in the nervous system. What is the correct order in which they
    9·2 answers
  • What are the mechanisms that cells deal with misfolded proteins and what is the ultimate fate of a misfolded protein inside of a
    12·1 answer
  • Wich groups of organic compounds found in living things are not energy rich
    15·1 answer
  • What are requirements or recommendations for a healthy diabetic diet
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Carbon absorbs energy at a wavelength of 150. nm. The total amount of energy emitted by a carbon sample is J. Calculate the numb
    15·1 answer
  • Identify the fuel that could be classified as a non renewable or renewable source.
    15·2 answers
  • Why is the solar system important
    9·2 answers
  • There is a great diversity of metabolism in microbes, with new types being discovered regularly. For example, the use of nanowir
    7·1 answer
  • The type of soil in an ecosystem determines the ______________.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!