1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
12

The most accepted Theory to make up living things is the

Biology
1 answer:
miv72 [106K]3 years ago
7 0
I think the most accepted Theory to make up living things is the cell theory.
You might be interested in
Heat is a form of engery.justify.​
Karolina [17]

Explanation:

The motion of atoms and molecules produces a form of energy that is present in all matter, called heat or thermal energy. ... Energy can take many forms, and from one form to another, it can alter. Many different energy forms can be transformed into heat energy

6 0
3 years ago
Read 2 more answers
What is the trait that is ancestral to all chordates?
Alla [95]
<span>The trait that is ancestral to all chordates is the presence of a notochord...the others are gill slits and nerve chord</span>
3 0
3 years ago
Read 2 more answers
TRUE OR FALSE<br> Nerve cells, or neurons, carry messages in one direction.
telo118 [61]

False!

Neve cells send messages from your brain and to your brain.

That's why you feel pain, etc

5 0
3 years ago
Can someone help me with does 4 questions please biology high school
mariarad [96]
15. B.
16. G. schlerenchyma cells
17. D. ATP
5 0
3 years ago
7. Which process produce four haploid cells?<br> a. Mitosis<br> b. Meiosis
Varvara68 [4.7K]

Answer: B. meiosis

Explanation: Meiosis is a process where a single cell divides twice to produce four cells containing half the original amount of genetic information. These cells are our sex cells – sperm in males, eggs in females. During meiosis one cell? divides twice to form four daughter cells.

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which portion of the central nervous system serves as the link between the brain and the peripheral nervous system?​?
    12·2 answers
  • An object is known to be 8,000 years old. What is this an example of?
    7·1 answer
  • The first phylum to have a true coelom is
    12·2 answers
  • THIS IS DUE TOMORROW can someone plz fill in the blanks
    9·1 answer
  • Several members of the same family were diagnosed with he same kind of cancer when they were unusually young. Which one of the f
    14·2 answers
  • In what ways are the respiratory structures of all animals similar?
    10·1 answer
  • Some animals can produce a potassium ion concentration inside their cells that is twenty times greater
    14·1 answer
  • How many bonds does P2 have?
    11·2 answers
  • What are the two that identify something has matter.​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!