1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
8

Early in mitosis the nucleus nucleolus and nuclear envelope begins to dissolve in preparation for cell division. In which stage

of the cell cycle is this process reserved
Biology
1 answer:
geniusboy [140]3 years ago
5 0
Early in mitosis, during prophase and prometaphase, the nucleus, nucleolus and nuclear envelope begin to dissolve in preparation for cell division. During telophase, which is the final stage in mitosis,, there is a reversal of effects of prophase and prometaphase; nucleus, nucleolus and nuclear envelope are again formed.
You might be interested in
Explain how the environment and economy has impacted because of coronavirus
aleksley [76]

Answer:

Corona Virus is helping the environment because people aren't constantly driving around and polluting the air. The economy, however, is dropping due to people not working and not making money and therefore, not spending as much money.

3 0
3 years ago
Read 2 more answers
Humans have<br> chromosome pairs.<br> DONE
dmitriy555 [2]

Answer:

True

Explanation:

Humans have 23 pairs of chromosomes, for a total of 46 chromosomes.

7 0
3 years ago
Our sense of ________ depends on olfactory cells located high in the roof of the nasal cavity.
Paha777 [63]

Sense of smell

Sense of smell is known to be part of the chemosensory system or chemical senses. It also a warning system that alert to danger signals such as fire, gas leakage or spoiled food. Thus, the sense of smell comes from the specialized sensory cells known as olfactory sensory neurons.

7 0
3 years ago
After reviewing the various drugs that are classified as barbiturates, a student demonstrates understanding when identifying wha
Stels [109]

Answer:

Diazepam.

Explanation:

Taxonomy is the field of the biology that mainly concerns with the classification, nomenclature, identification an systematic of the organisms. Different categories are isoltype, holotype, haplotype and prototype.

Pototype may be defined as a type of model used in the  cognitive science for the graded categorization. In the prototype some species is considered more central than the other species. In the given question, the diazepam can be used as a prototype.

Thus, the answer is diazepam.

6 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Other questions:
  • In which process, identified in the image, is a mutation first able to develop?
    13·1 answer
  • Which is the best definition of a phylogenetic tree
    8·2 answers
  • Which best defines homeostasis
    5·2 answers
  • What does an animal do when it respires
    9·1 answer
  • Starting in 1850 when Europe become industrialized, the frequency of melanic forms of the peppered moth in populations ______ un
    10·1 answer
  • Which of the following would NOT characterize allopatric selection?
    14·1 answer
  • Hey, can someone help me with three questions in biology? Thanks.
    10·1 answer
  • Golf drives travel much farther than Major League home runs. Why might this be?
    8·2 answers
  • Which is an a word that shows the outlet isn't completely sure about a particular statement
    12·1 answer
  • Which endocrine organ is responsible for the production of adh oxytocin and regulatory hormones?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!