1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
5

The process by which the digestive system breaks down food into molecules that the body can use is called

Biology
2 answers:
zubka84 [21]3 years ago
7 0
C, d, c, b, c
in that order
mylen [45]3 years ago
5 0

Answer:

The correct optios are: digestion (c), eliminated from the body as wastes (d), epiglotis (b), esophagus (b), liver (d)

Explanation:

We called digestion to the process by which particles composing food are break in small particles that can be absorbed into blood. Some structures can be digested and absorbed but other ones (such as cellulose for example) can not and are eliminated from the body as wastes.

Epiglotis is a cartilaginous structure that separates respiratoty system from digestive system, avoiding the passage of food to respiratory sytem.

Esophagus is a muscular tube that constitutes the conection between pharynx and stomach.

Liver is an important organ that segregates bilis (between other functions) which is esential for digestion of fat. Bilis can be stored in gall bladder after its production in liver.

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What is the most likely result of a cell with a mutation in the gene that codes for the enzyme primase?
Andreyy89

Answer:

The consequences will depend on the type of mutation. For example, if the mutation is synonymous it will not have negative effects on the cell function. On the other hand, if the mutation produces amino acid diversity it may cause loss of function

Explanation:

Primase is an RNA polymerase that adds RNA nucleotides to the complementary DNA strand in order to prepare it for the RNA polymerase III during transcription initiation

5 0
3 years ago
The energy associated with the random motion of molecules or atoms within a substance is A. electromagnetic energy. B. thermal e
butalik [34]
I think B. thermal energy.
When we heat up a substance, we increase the motion or vibration of the particles.
3 0
3 years ago
Read 2 more answers
Which conditions are possible reasons for declining genetic diversity of a species.
Natali5045456 [20]

Answer:

Explanation:

loss of habitat

inbreeding

environmental changes

widespread distribution

8 0
3 years ago
GIVING BRAINLEST!!
Mkey [24]

Answer:

4 worms per week

Explanation:

if 9 worms are born per week and 5 die, 9-5=4

8 0
2 years ago
Read 2 more answers
Other questions:
  • The blood type A,B,AB,and O are results of ____ inheritance.
    9·2 answers
  • Which of the following is not a symptom of the second line of defense, the inflammatory response?
    5·1 answer
  • Which of the statements regarding enzymes is FALSE? *
    9·1 answer
  • Which of the following statements is true of meiosis? (2 points)
    10·1 answer
  • What is the frequency in vibrations per second of a 200 hertz wave?
    11·1 answer
  • During a hypoperfusion state in the​ body, what division of the autonomic nervous system is responsible for initiating the negat
    8·1 answer
  • What did Mendel Conclude determines biological inheritance
    10·1 answer
  • How do fossil fuels contribute to air pollution?
    15·2 answers
  • Giving away 17 points!! Please help me ASAP!!!
    11·1 answer
  • Access of therapeutic drugs to the central nervous system is restricted compared to that of other tissues because of the presenc
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!