1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WINSTONCH [101]
3 years ago
13

How is an apex consumer different from a primary consumer? Give an example.

Biology
1 answer:
Ivan3 years ago
3 0

Answer: Within an ecological food chain, Consumers are categorized into primary consumers, secondary consumers, tertiary consumers. Primary consumers are herbivores, feeding on plants. Caterpillars, insects, grasshoppers, termites and hummingbirds are all examples of primary consumers because they only eat autotrophs (plants). (noun) consumers with few to no predators of their own, residing at the top of their food chain. Explanation:

You might be interested in
How is repetition and replication alike
Colt1911 [192]
Both provide approach to confirming the result of experimentation.
4 0
3 years ago
Which of the following statements are true about the homologous chromosomes of a pair?
Black_prince [1.1K]

The statement that is true about homologous chromosomes of a pair is that homologous pair have the same genes at the same location (loci), but will possibly have different alleles.

<h3>What are homologous chromosomes?</h3>

Homologous chromosomes are set of chromosomes that possess similar but non-identical genes.

Homologous chromosomes are from each parent of an organism i.e. male and female parent.

The homologous chromosomes is responsible for the diploid state of an organism, however, it becomes separated during the anaphase 1 stage of meiosis.

Therefore, the satement that is true about homologous chromosomes of a pair is that homologous pair have the same genes at the same location (loci), but will possibly have different alleles.

Learn more about homologous chromosomes at: brainly.com/question/27258467

#SPJ1

5 0
2 years ago
Almost all living organisms use the same basic biochemical molecules including blank
vodomira [7]
Including DNA ATP, & many identical or nearly identical enzymes.
6 0
3 years ago
Read 2 more answers
Breaking down food (glucose) into usable
velikii [3]

answer:

metabolism

Explanation:

7 0
4 years ago
What produces enzymes?
AlexFokin [52]

Answer:

Pancreas

Explanation:

4 0
3 years ago
Other questions:
  • Cystic fibrosis is an example of a genetic disease caused by the deletion of a nucleotide. what is the term for this type of mut
    13·1 answer
  • One way for a family to determine their energy use is by analyzing their electric bill each month. Most energy bills include a g
    5·2 answers
  • The brightest star in the universe, a supernova, is thought to be about a million times brighter than our own Sun. If Polaris, l
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is microalgae? What benefit would they have in this technology?
    15·1 answer
  • How do I find the codon and anti codon? :)​
    9·1 answer
  • If you are walking on an island formed by an underwater volcano,
    14·2 answers
  • 9. How does just-in-time production improve efficiency of processes?
    11·1 answer
  • During vigorous exercise, one would expect: Question 5 options: Blood to be diverted from the brain Blood to be diverted to the
    6·1 answer
  • 1. Imagine that you are talking with someone who has never heard of environmental racism
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!