1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
2 years ago
6

Although the main role of carbohydrates and lipids is to provide energy; vitamins, minerals, and ________ must also be present i

n the cell.
Biology
1 answer:
Nastasia [14]2 years ago
4 0

Answer: Water

Explanation:

There are 6 nutrients in the body which helps in keeping the body healthy. These components are carbohydrates, fats and proteins. These molecules helps in providing energy to the body.

The vitamins minerals and water is equally important for the cells as it helps in carrying out various types of reactions inside the body.

All the macro and micro nutrients are important for keeping the body healthy.

You might be interested in
Asexual reproduction produces offspring that are genetically _______ to the parent.
muminat

I wanna say identical

Hope this helps

God bless you

-Kayla <3

7 0
2 years ago
How does breathing and heart rate change as someone runs up a slope?
dangina [55]

Answer:

Heart rate goes up, breathing gets labored

Explanation: heart using more blood to work, and then the heart needs more oxygen to work so it forces u to breathe more

Hope this helped!

8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Which evidence has led scientists to conclude that there are different layers within Earth's interior?
Elenna [48]

Answer:

Explanation:

1) análisis de datos de ondas sísmicas

8 0
2 years ago
Urgent <br><br> DOes DNA contain organelles
Talja [164]
Yes because every single organism requires dna
5 0
3 years ago
Read 2 more answers
Other questions:
  • What are genes? Question 3 options: A the observable characteristic B the expressed trait C the basic unit of inheritance D the
    9·1 answer
  • Plzz help!!'<br><br> in complete sentences, compare the circulatory system of a plant and an animal
    7·2 answers
  • Earth’s crust continuously melts and solidifies in the upper mantle. Why does oceanic crust solidify faster than continental cru
    7·2 answers
  • Day and night are caused by A. the rotation of the Sun on its axis. B. the Sun completing a full orbit around the Earth. C. the
    6·2 answers
  • Why must the use of pesticides be carefully controlled?
    11·2 answers
  • There are 40 white beans representing the recessive allele, (b), which codes for white fur. There are 40 brown beans representin
    8·1 answer
  • #4 <br> The right side of the heart pumps blood only to the ____________ .
    8·2 answers
  • A student uses gummy worms to model the process of mitosis. The model is shown below.
    14·1 answer
  • True or False? Endurance training results in an increase in parasympathetic nervous activity and this allows for a reduced resti
    13·1 answer
  • You stain a sample of bacteria using the Gram stain and see gram-positive rods. You then test a sample of the same bacteria usin
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!