1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina CMI [18]
4 years ago
13

Alfred has a golden retriever named Max. Max can recognize people from their smell. Max starts to bark and wag his tail when Alf

red reaches the gate of his house, even though Max is 50 yards away in his kennel. What are the reasons for Max’s ability to smell so well?
A.) Dogs have more olfactory receptors in their noses, allowing them to identify people by their smell.

B.) Dogs have highly sensitive olfactory receptors, allowing them to distinguish a person’s unique odor.

C.) Dogs have better eyesight than humans, allowing them to see faraway objects.

D.) Dogs have an extended nervous system, allowing them to detect even the slightest movement in humans.

E.) Dogs have connected optic and olfactory systems, allowing them such precision in smell.
Biology
2 answers:
Ipatiy [6.2K]4 years ago
8 0
The answer is b thank and rate my answer for 30 points they come in in 35 minutes
Ronch [10]4 years ago
7 0

Answer:

A.) Dogs have more olfactory receptors in their noses, allowing them to identify people by their smell

Explanation:

There are reports that dogs have 4 times more olfactory receptors than other animals. These animals have between 200 and 300 million olfactory receptors, it is a high figure when compared to the 5 million people have.

The dogs have turrets, which are covered by a mucosa with many folds. Thanks to these bone structures and these folds, the surface of their olfactory mucosa increases significantly and, consequently, their olfactory receptors also multiply

You might be interested in
(PLEASE HELP !!!!!???!!)
Fed [463]

Answer:

idk if it's good..

Explanation:

The dark-colored mice arose in the population at location A by random mutation. ... advantage over light-colored mice in that environment. • Over time, dark-colored mice became more common at location B because more of their offspring survived. to reproduce and pass on their genes, including genes for fur color.

3 0
3 years ago
Most of the energy in the United States comes from:
Grace [21]
Solar power/energy or hydroelectric plants
8 0
3 years ago
Tying the legs and wings of poultry against the body to make a compact unit for cooking is called
dimaraw [331]
Tying the legs and wings of poultry against the body to make a compact unit for cooking is called trussing.

The purpose of this is even cooking an a more attractive appearance.
5 0
3 years ago
People of all ages were impacted by the expansion and availability of the internet in 1990s. this is an example of what kind of
Karo-lina-s [1.5K]
B. Modernization effect
7 0
3 years ago
The energy required for photosynthesis is provided by
konstantin123 [22]

sunlight..........................

4 0
3 years ago
Read 2 more answers
Other questions:
  • How is it possible that phylogenies based on sequences from nuclear genomes and organellar genomes (i.e., chloroplasts and mitoc
    8·1 answer
  • Compare and contrast point mutations and chromosome mutations and explain the basis for classifying a mutation as beneficial, ne
    5·2 answers
  • The inner membrane folds of mitochondria, where many of the reactions of aerobic cellular respiration occur, are called
    12·1 answer
  • a chemistry student is adding a solid to a liquid in a jar. What would put the student in danger during this experiment
    15·2 answers
  • This is a substance that is required in large amounts for survival and sustainability.
    5·1 answer
  • Immediately following the arrival of the stimulus at the axon terminal of a motor neuron there is a short period called the ____
    5·1 answer
  • Andrew noticed Michael and his pregnant wife Georgette walking down the street and drove his car very close to Michael, and honk
    8·1 answer
  • The blood type trait is controlled by more than two alleles for a given gene and therefore is called multiple alleles.
    5·2 answers
  • 13
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!