1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
9

Which factor is different between the tundra biome and tundra ecosystems

Biology
1 answer:
igomit [66]3 years ago
5 0

Answer:

Tundra Characteristics

The tundra and taiga represent the two coldest land biomes on the planet, but they have different precipitation levels, and the tundra has permafrost. These two factors cause sharp differences between the plant life of the two biomes, and the resulting local animal populations.

Explanation:

You might be interested in
What affects do islands have on animal size
Sever21 [200]

There's two effects that the islands have on the size of the animals, reducing of size, or increasing of size. The reducing of size is known as island dwarfism, while the increase in size is known island gigantism.

The effect of the island environment effects different types of animals in different manner, and it also has to be taken in account the size of the island. In general, the small animals tend to increase their size on the islands, while the large animals tend to decrease in size. The reason for this is that the smaller animals, because of the isolation, usually lack predators or they are very few, but also have sufficient amounts of food, thus they grow in size. The larger animals though, decrease their size because there isn't enough food on the islands to support them, thus with the decrease in size they consume less. Also, since they usually lack predators, they do not have to be large in order to defend themselves.

7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
In a mob, all it takes is one dominant and electric individual to convince people to act through the
marshall27 [118]

Answer:

Yes.

Explanation:

Yes, In a mob, one dominant and electric individual has the ability to convince people to act through the  effect. This individual is the person who bring these people to fight for their rights and all the people of the mob obeys his orders and he is the only person who can stop these people from causing trouble and violence. All the people in the mob considered him their leaders and follow him in every decision.

8 0
3 years ago
The state of maintaining a stable internal environment regardless of changing external conditions is called
Alex787 [66]

The state of maintaining a stable internal environment regardless of changing external conditions is called \sf\purple{homeostasis}.

\bold{ \green{ \star{ \orange{Mystique35}}}}⋆

5 0
3 years ago
Need help plsss I will give u 100 points
Rufina [12.5K]

Answer: Mrs.Connor

Explanation:I just want to go with is the flow.

8 0
2 years ago
Other questions:
  • How are hosts and parasites related?
    10·2 answers
  • How do plants obtain, transport, release, and eliminate matter and energy?
    8·1 answer
  • If a DNA molecule is 22% adenine in any organism, which percentage of thymine will that DNA molecule contain?
    11·1 answer
  • Describe how changes in an ecosystem can affect organisms that live there.
    10·2 answers
  • What are two basic differences between DNA and RNA?
    6·2 answers
  • What happens when blood sugar is low
    14·1 answer
  • If you flip a penny 99 times and each time it came up heads then the chance of the penny coming up heads is ___
    6·1 answer
  • The frequency of a drum note is 20Hz. what does this tell you about the drum skin movement
    13·2 answers
  • HELP ASAP I NEED THIS ANSWER!!! A scientist is observing a worm that was found inside a host. The worm has an outer body that is
    12·2 answers
  • How many weeds are on the noxious weed list?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!