1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
3 years ago
8

Please Help!

Biology
2 answers:
Brut [27]3 years ago
6 0

Answer:

only in the nucleus

Explanation:

DNA replication is when DNA makes another copy of itself. DNA replication is needed in order to maintain the number of chromosomes that is characteristic to a species during cell division. During cell division, one parent cell divides into two daughter cells. If DNA replication did not occur, then the daughter cells would receive only half the number of chromosomes characteristic of that species.

Ksivusya [100]3 years ago
5 0

Answer:

I believe it is the "Nucleus."

Explanation:

Hope my answer has helped you!

You might be interested in
Surprisingly, in a number of reactions in which either ATP or GTP are involved, the critical event is not due to the hydrolysis
kkurt [141]

Answer:

The correct answer is option d. "phosphorylation of glucose".

Explanation:

The phosphorylation of glucose is one of the most important catabolic reactions that allow to obtain energy from sugars. This reaction is the first step of glycolysis and avoid cells to lose sugars by diffusing back to its transporter. The phosphate used to phosphorylate glucose comes from the hydrolysis of one of the three phosphate of adenosine triphosphate. Therefore, phosphorylation of glucose is a processes where ATP hydrolysis is directly involved.

7 0
4 years ago
What is the answer to this?
zloy xaker [14]

Answer:

The location in which it stores its genetic material.

Explanation:

3 0
3 years ago
What type of nosocomial infection is likely to arise from intravenous catheterization?
mrs_skeptik [129]

Answer:

The correct answer is c. Bacteremia

Explanation:

Nosocomial infection is a hospital-acquired infection. Intravenous catheterization is majorly used in hospitals for therapeutic purposes like drug administration, blood sampling, etc.  

These catheters are one of the major causes of nosocomial bacteremia in patients. Bacteremia is the condition in which bacteria is present in the blood.

So these catheter can be contaminated with bacteria which came from a patient and when they are used in another patient without proper sterilization they can transfer these bacteria to other patients blood which then cause nosocomial bacteremia.  

8 0
3 years ago
What causes cancer cells to develop?
erik [133]

The answer is; cancer occurs due to unregulated cell division

This causes them to proliferate causing a mass of cells and affect neighboring tissues. The cells are usually undifferentiated and therefore do not function properly as tissue. This unregulated division is due to malfunction of the tumor suppressor gene that is significant in cell cycle regulation and apoptosis.

6 0
3 years ago
ACT FAST, HURRRY!What are the MAJOR functions in the digestive system? Brainliest for most answers!
CaHeK987 [17]
I think atleast one is Oxygen because it needs air to digest
3 0
3 years ago
Other questions:
  • Give an example of spinal reflex and explain how the nervous system functions in this reflex action
    8·1 answer
  • Name the final form of chemical energy produced by cells during cellular respiration
    13·1 answer
  • As ____________ increases, the two-point threshold decreases. receptor number receptor density receptor sensitivity receptor sen
    8·1 answer
  • Cystic fibrosis is a devastating illness that affects the lungs, pancreas, and intestines.In 1989, researchers discovered that t
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Resting energy expenditure maintains heartbeat, respiration, nervous system function, muscle tone, and body temperature to name
    7·1 answer
  • what process involving cell division results in daughter cells that are not identical to the parent cell?
    10·1 answer
  • Page 7e) Mrs. karki deposited a sum of money 7aa in a bank at the rate of 5 90 per year Simple interest. T. She received an inte
    9·2 answers
  • Meteorites formed a long time ago in the early solar system.<br> True or False
    14·2 answers
  • True or False - Albert Einstein was one of the most influential scientists invovled in cell theory?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!