<span>If a compound could interfere with bacterial cell wall synthesis, it would destroy the cell. The bacteria would not survive failure of the cell wall. This compound would be useful in the treatment of bacterial infection as it would destroy the infection on a cellular level.</span>
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
The quantity of water in the water table can change rapidly depending on the rate of extraction. As the level of water decreases in the aquifer, there is less available water to be pumped. If the rate of potential groundwater recharge is less than the rate of extraction, the water table will be too low for access.
An average temperature is 288 degrees Fahrenheit.Saturn is a pretty cold planet.
A mouse has a greater ratio of surface area rather than a hippopotamus.
