1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lilit [14]
3 years ago
8

Plz help me with this

Biology
2 answers:
mariarad [96]3 years ago
8 0
"The Gulf Stream, together with its northern extension towards Europe."

hope this helped give me the brainlies answer ---------------->: )

pshichka [43]3 years ago
5 0
The Golf Stream. I Think

You might be interested in
Which law of motion is accociated with inertia
zaharov [31]
Newtons first law of motion have a very nice day

4 0
3 years ago
Match the following terms and definitions. 1. an organism that can make its own food commensalism 2. a symbiotic relationship be
Dmitriy789 [7]

Terms matched with the right definitions.  

1. An organism that can make its own food – Autotroph

2. A symbiotic relationship between two organisms in which one species benefits and no effect is apparent to the other species – Commensalism.  

3. A cell that has a membrane-bound nucleus and/or organelles as its major characteristic -Eukaryote.  

4. The study of organisms that are too small to be seen with the naked eye - Microbiology.  

5.  A disease-causing organism - A germ pathogen.  

6. A one- or few-celled organism with chromosomes; may have characteristics of both animals and plants – Protist.


An autotroph is an organism that produces its own food from simple substances available in its environment. Autotrophs usually use inorganic chemical reactions or light energy in producing their food and are usually the producers in a food chain. Examples of autotrophs are plants and algae.


Commensalism is a type of relationship between organisms of two species where one organism benefits from the relationship and the other organism is not affected by it (neither benefits nor harmed).



5 0
4 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
A formula-fed baby is more likely to ________ than a breastfed baby. get more iron have more allergies visit the doctor less hav
Reptile [31]
The answer is Have more allergies.
The type of nutrient intake that babies have in early development would affect the stability of gut<span> microbiomes that exist in their body.
Breastfeed babies tend to have more microbiomes that help them fight of foreign objects that come inside their system, and prevent allergies.</span>
5 0
3 years ago
An overweight, 14-year-old boy feels tired all the time. he sleeps 12 to 14 hours a day and has a voracious appetite but no ener
vampirchik [111]
<h3><u>Answer;</u></h3>

Myxedematous coma

<h3><u>Explanation;</u></h3>
  • Myxedema coma is a severe hypothyroidism leading to decreased mental status, hypothermia, and other symptoms related to slowing of function in multiple organs.
  • it is a loss of brain function as a result of severe, longstanding low level of thyroid hormone in the blood.
  • It is a rare life threatening complication of hypothyroidism.
8 0
3 years ago
Other questions:
  • How does most of the carbon in an organisms body return to the environment after the organism dies
    5·2 answers
  • Similarities and differences between prokaryotic cells and eukaryotic cells
    9·2 answers
  • Defined as variation of life on earth, ____________ is the number and relative abundance of different ____________
    5·1 answer
  • Write the solution in the form and . (use the parametrization derived from the row-reduced echelon form after reindexing the and
    13·1 answer
  • 4) Compare and contrast passive transport (including osmosis and facilitated transport) with active transport such as endocytosi
    15·1 answer
  • Define: Enzyme (in your own words) <br> plz help
    6·1 answer
  • What is the pathway of the respiratory system?
    7·1 answer
  • Which statement is true of y chromosomes
    6·2 answers
  • Define habituation. The definition
    5·1 answer
  • In a culture of bacteria, there are some individuals that are unable to synthesize histidine. What is the best and most likely d
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!