1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
3 years ago
14

Which of the following accurately describes kidney function? A. Kidneys are directed by the presence of antidiuretic hormone to

excrete more water in urine. B. Kidney function is controlled by the blood's composition and hormones. C. Kidneys will excrete salts if you have too little in your blood. D. Kidneys can excrete salts, but not glucose.

Biology
1 answer:
defon3 years ago
6 0
Answer - B. Kidney function is controlled by the blood's composition and hormones.

Reasoning - Well to start off the kidneys (main) purpose function is to clean your blood which is very Important with blood composition. Second It can also and will excrete it through urine which is pretty much what it does. Oh and also a little bit of hormones. 

You might be interested in
The trait for red hair is recessive, meaning that when a person expresses two copies of this allele they have red hair. what can
AlekseyPX
Let "r" stand for the recessive red hair trait. A person with red hair must have a genotype of "rr" ( one from each parent) in order to have red hair( red hair being the phenotype).

Let "B" stand for brown hair and "b" stand for not brown hair. A person with brown hair can have a genotype of "Bb" or "BB" and have a phenotype of Brown hair. This is becasue brown hair "B" is the dominant trait.
5 0
3 years ago
What are the benefits/risks associated with the addition of antibiotics and genetically modified
Korolek [52]
One major risk is mutation. Diseases can mutate just has how we have genetic mutations. The bacteria in the cattle may become immune to the drugs over a long period of time, or mutate and become immune. As we try to fight it with more antibiotics, it may become immune to those as well, eventually creating a bacteria immune to most antibiotics, leaving us unable to fight it, especially in poorer areas, due to the fact that if we did create new antibiotics they would be more expensive than your common antibiotic, such as penicillin.<span />
4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
For the growth curve to continue increasing, which of these must occur?
padilas [110]
I know the answer but where is the pic to show the acaod
4 0
3 years ago
What is one function of proteins
mrs_skeptik [129]

Answer:

It helps repair and build your body's tissues, allows metabolic reactions to take place and coordinates bodily functions.

Explanation:

8 0
3 years ago
Other questions:
  • At which temperature dose lactase work fastest?
    11·1 answer
  • Explain how XY mice with a duplication of chromosome 1 develop<br> ovaries and a female phenotype.
    8·1 answer
  • If not for human activities how long would carbon stay as fossil fuels?
    10·1 answer
  • How are complementary strands of DNA held together?
    6·2 answers
  • What is the active ingredient of aspirin that would provide clues about its classification by ph (acid, base, neutral)?
    7·1 answer
  • According to the scientific method, how would you test a hypothesis?
    12·2 answers
  • What is the function of RNA polymerase in protein synthesis? a) It brings the tRNA to the ribosome. b) It bonds the DNA strand.
    5·2 answers
  • Using the data you just reviewed, create a scientific argument of one to two paragraphs that support or oppose the current flu v
    12·2 answers
  • Which of the following is(are) non-technological ways of improving air quality?
    12·2 answers
  • Amkphgnezr​<br>join join​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!