1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korolek [52]
2 years ago
15

An electrochemical cell is connected to a current by its____.

Biology
2 answers:
AlexFokin [52]2 years ago
3 0

Answer:

b

Explanation:

DanielleElmas [232]2 years ago
3 0

Answer:

b

Explanation:

You might be interested in
Asking ........ and defining ...........
stellarik [79]

Answer:

Sorry, I'm confused there has to be more to it if there is not then there is no true way for anyone to fill in the blanks. <3

6 0
2 years ago
Refer to the invertebrate cladogram above to answer the following questions.
Alex787 [66]
1. Multicellular
2. Multicellular, tissues, bilateral symmetry, body cavity, coelom, segmentation, jointed appendages, exoskeleton
3. Annelids 
4.Jointed appendages, exoskeleton
5. Evolutionary phylogeny is unknown, but it is known to have some of these adaptive traits (multicellular, tissues, bilateral sym, body cavities, coelom)
6.sponges, jellyfish, roundworms, snails
3 0
3 years ago
Read 2 more answers
What type of limiting factor is space <br>A.) abiotic<br>B.) biotic​
ser-zykov [4K]
The answer is biotic
8 0
2 years ago
Read 2 more answers
True or false: microorganisms in the water provide nutrients for coral, sponges ,and some fish.
Orlov [11]
I think the answer is true

8 0
3 years ago
A plant cell has lost too much water due to evaporation by the sun. It needs more water from other cells. What structure would a
Elan Coil [88]
The answer is D.cellulose
5 0
3 years ago
Other questions:
  • Developing an _____ made absorptions of nutrients more efficient for round worms Answer Choices are A. Coelom B. Mouth C. Anus
    7·1 answer
  • I'm desperate. Please help me with this question
    12·1 answer
  • The image shows the 'popped' endosperms of popcorn. What purpose does the starchy endosperm serve? A) food storage B) reproducti
    7·1 answer
  • Who came up with the continental drift theory? What does it state? <br> fast fast
    9·1 answer
  • In what ways do scientists share information ? <br><br> HELP Please
    14·1 answer
  • Which statement explains why oxygen molecules easily diffuse across a cell membrane while glucose molecules do not?
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What are the visible effects of hotspots on the Earth's surface?
    12·2 answers
  • Explain the relationship between photosynthesis and cellular respiration using the following words: Photosynthesis, Cellular res
    8·1 answer
  • Which phase occurs directly after S phase?<br> • A. G2<br> B. G1<br> C. Cytokinesis<br> D. M phase
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!