1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
3 years ago
14

Name one advantage of scientists knowing human genetic information?​

Biology
1 answer:
Jlenok [28]3 years ago
8 0
They can find diseases
You might be interested in
How do non green leaves photosynthesize
Dafna1 [17]
Basically six molecules of water (H2O) plus six molecules of carbon dioxide (CO2) in the presence of light energy produce one molecule of glucose sugar (C6H12O6) and emit six molecules of oxygen (O2) as a by-product. That sugar molecule drives the living world. Animals eat plants, then breathe in oxygen, which is used to metabolize the sugar, releasing the solar energy stored in glucose and giving off carbon dioxide as a by product
8 0
3 years ago
Read 2 more answers
How is nitrogen metabolism in the prokaryotes vital to other organisms? given the roles of bacteria in the nitrogen cycle, how w
Murljashka [212]
Metabolizing nitrogen in prokaryotes is very important to other organisms since these prokaryotes are able to convert ammonium in the soil to nitrate and, then, the denitrifying bacteria could use the nitrate produced instead of using oxygen in their metabolism in order to release nitrogen molecules. by the denitrification process, thus completing the nitrogen cycle. Without the nitrogen metabolism in prokaryotes, the nitrogen in the atmosphere could not be used or utilized to synthesize essential organic compounds that are needed by other organisms. It is only the prokaryotes that has the ability fixing nitrogen or can do the process of nitrogen fixation.
5 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Please help me with this matching.
jarptica [38.1K]
1. A
2 E
3 F
4 C
5 G
6. B
7. D
4 0
4 years ago
Will mark brainliest and use your own word
Ivahew [28]

Answer;

im confuzzled but it might obviously be B. if im correct.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement BEST describes how the two techniques differ in reducing fungal infestations of crop plants? A) Fungicides kill
    11·2 answers
  • Refer to the chart of amino acid structures to help answer this question. Which four statements about amino acids are true? Ser
    14·1 answer
  • Pyruvatic acids are formed during which stage of cellular respiration?
    14·2 answers
  • What must nonphotosyntheic organism must do to obtain glucose
    6·1 answer
  • A frustrated 26-year-old female has sought a referral to a dermatologist in an effort to resolve her sweating and body odor whic
    11·1 answer
  • AB+CD (reactant~higher on graph) ---> AC+BD (product~lower on graph)
    5·1 answer
  • For hundreds of years one species of moth has always gone back to the same type of tree in the forest to breed. A small portion
    6·1 answer
  • Please help me now hurry​
    8·2 answers
  • 2. A certain recessive, lethal gene is carried on the X chromosome. (Lethal genes are those that result in death.) A man marries
    14·1 answer
  • ANALOGY: Photosynthesis: production of glucose, as cellular respiration: _____
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!