1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
12

If the producer contains 6000 of energy how much energy will the secondary consumer contain

Biology
1 answer:
AVprozaik [17]3 years ago
8 0
The proportion of energy transferred from one trophic level to the next is known as trophic level transfer efficiency or ecological efficiency. The Ten Percent law states that 'net production at one trophic level is generally only 10% of the net production at the preceding trophic level'. In this example, the producer contains 6000 units of energy. 10% of this will be transferred to the primary consumer, i.e. 600 units. In turn, 10% of this energy will be transferred to the secondary consumer i.e. 60 units.
You might be interested in
In an example food chain, rabbits only eat plants.<br> Which type of consumer are the rabbits?
xz_007 [3.2K]

plants and algae. These organisms are called primary consumers or herbivores. Some examples are rabbits, deer, tadpoles, and caterpillars. organisms are called secondary consumers.

7 0
3 years ago
Read 2 more answers
Which two sentences the characteristic of a prokaryot
Natali [406]

Answer: Prokaryotes lack an organized nucleus and other membrane-bound organelles. Prokaryotic DNA is found during a central a part of the cell called the nucleoid. The plasma membrane of a prokaryote acts as an additional layer of protection, helps maintain cell shape, and prevents dehydration.

Explanation:

6 0
3 years ago
Read 2 more answers
What evidence for the age of the Earth is indicated by the fact that sedimentary rock is found on mountain tops? that the Earth
Ket [755]

The correct answer is - That some force lifted the rocks from the water.

The fact that there's sedimentary rocks on the tops of the mountains is an evidence that there has been some force that managed to lift upwards parts of the seafloor. Taking into consideration how slowly this force manages to lift up parts of the Earth, we can easily assume that the Earth is very old. The amount of time that is needed for a part of the seafloor to be lifted few thousand meters upwards is counted in tens of millions of years, thus giving us evidence that the Earth has been around for a very long time.

8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The energy required for photosynthesis is provided by
konstantin123 [22]

sunlight..........................

4 0
3 years ago
Read 2 more answers
Other questions:
  • Enter the molecular formula for butane, C4H10. Express your answer as a chemical formula.
    13·1 answer
  • Which part of the cell membrane allows the cell to exist in water?
    11·2 answers
  • What would happen if one of the nucleotide base pairs is mismatched?
    5·1 answer
  • Plants use photosynthesis to meet their survival needs by enabling them to
    10·1 answer
  • Few complete fossils are ever discovered due to the rapid decomposition of most deceased organisms and the specific conditions m
    13·2 answers
  • 3. Sea level refers to an elevation of O feet. *<br> rue<br> O True<br> O False
    12·2 answers
  • 11. What did Darwin think about on his journey home to England?
    10·1 answer
  • Can u help me? guys alleast 1,2 question maybe​
    5·1 answer
  • 1) Label the following terms in the following picture
    15·1 answer
  • Which of the following statements are true about meiosis II?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!