1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irinina [24]
3 years ago
8

The numbers in the food chains shown here represent the amount of oil droplets consumed. Which food chain best shows the results

of biomagnification after an oil spill?
Stingray 1,000 arrow pointing right Seahorse 2,500 arrow pointing right Copepods 10

Seahorse 10 arrow pointing right Copepods 2,500 arrow pointing right Stingray 1,000

Copepods 1,000 arrow pointing right Stingray 10 arrow pointing right Seahorse 2,500

Copepods 10 arrow pointing right Seahorse 1,000 arrow pointing right Stingray 2,500
Biology
1 answer:
viva [34]3 years ago
8 0
Copepods will be the least effected by the oil spill.

Therefore I believe the correct answer should be Copepods 10 arrow pointing right Seahorse 1,000 arrow pointing right Stingray 2,500

Good luck! Hope this helps!
You might be interested in
Describe how scientists would have to use to classify M.smithii into archea domain
stiks02 [169]

Explanation:

Archaea were initially classified as bacteria, receiving the name archaebacteria (in the Archaebacteria kingdom), but this term has fallen out of use. Archaeal cells have unique properties separating them from the other two domains, Bacteria and Eukaryota. Archaea are further divided into multiple recognized phyla

6 0
3 years ago
Read 2 more answers
What is NOT a characteristic of saturated fats
Elenna [48]

Answer:

A) Fats provide 12 kcals of energy per gram.

8 0
3 years ago
Why do developing countries experience greater growth?
MAVERICK [17]

Because since developing countries are still growing, when they finally get to the level of some more advanced countries the country as a whole feels a "greater growth"

8 0
3 years ago
Read 3 more answers
German scientist Alfred Wegener is best known for what hypothesis?
Jobisdone [24]
The theory of Continental Dift
6 0
3 years ago
The one on the bottom
bonufazy [111]
Natural selection or survival of the fittest can cause a major evolution as the species at risk need to stay alive and therefore need to become more adapted to the situation at hand. The species can evolve through generations to become more crafted to the predatorial habits of their predators. If the females are less at risk than the males then the males might evolve to become more protected or if some of the species live in a different situation maybe not even that far away, that can have a big impact on the evolutionary habits of the species at hand.


I hope I'm right
8 0
3 years ago
Other questions:
  • Which process produces oxygen?
    5·1 answer
  • Which substance is an inorganic molecule?<br> A) starch B) DNA C) water D) fat
    11·2 answers
  • When does slime seem more like a solid and when is it more like a liquid?
    11·1 answer
  • What is shifting cultivation​
    11·2 answers
  • Catalase is an enzyme that is found in all living tissues. Cells need catalase in order to function properly. Which of the follo
    6·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Select the correct statement regarding epithelia.A) Simple epithelia form impermeable barriers.B) Stratified epithelia are prese
    12·1 answer
  • During cell reproduction, chromatin fibers coil up into structures called
    6·1 answer
  • . In the video, two different domains of prokaryotes were discussed. In a six kingdom system, these prokaryotes can also make up
    13·1 answer
  • Which of the following statements describes how the prokaryotic cell appear compared to the eukaryotic cells?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!