1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serjik [45]
3 years ago
7

Why might a plant that normally grows in one environment not grow well in a different environment​

Biology
2 answers:
Burka [1]3 years ago
7 0

Answer:

Different enviroment may not sustain an organism's life

Explanation:

If you put a jungle tree in a desert, will it survive?

There are all sorts of factors like humidity and temeperature.

hichkok12 [17]3 years ago
5 0

Answer:

A plant that normally grows in one environment not grow well in a different environment because every flower is different around the certain providing environment.

Explanation:

You might be interested in
The term genotype refers to
DanielleElmas [232]

Answer:

In a broad sense, the term "genotype" refers to the genetic makeup of an organism; in other words, it describes an organism's complete set of genes. In a more narrow sense, the term can be used to refer to the alleles, or variant forms of a gene, that are carried by an organism.

Explanation:

5 0
2 years ago
What is not a characteristic of water-soluble vitamins?​?
maxonik [38]

that they are not soluble with water


3 0
3 years ago
Which of the following cell components are most involved in determining an organisms traits
mel-nik [20]

Answer:

chromosomes because they carry the DNA.

Explanation:

7 0
2 years ago
What type of media is used to demonstrate oxygen requirements of microbes? blood agar thioglycollate sulfite polymyxin sulfadiaz
Alex73 [517]
The correct answer is thioglycollate.
3 0
3 years ago
What happens when a mechanical wave runs through a medium?
Volgvan

Once this initial energy is added, the wave travels through the medium until all its energy is transferred. In contrast, electromagnetic waves require no medium, but can still travel through one.

3 0
2 years ago
Other questions:
  • What is the connection between a circadian rhythm and the biological clock​
    5·1 answer
  • what relationship was used to form the analogy "blood vessels are to circulatory as hair is to integumentary"?
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • During perspiration the entropy of the water
    13·1 answer
  • 1. What is the result of a rock undergoing physical weathering?
    11·1 answer
  • Some organisms have traits that help them survive in certain situations, while others of the same species do not. These differen
    15·2 answers
  • SF medium is a selective medium, developed in the 1940s, to test for fecal contamination of milk and water. Only certain gram-po
    8·1 answer
  • 1) Eubacteria cells lack a nucleus, and are therefore________
    9·1 answer
  • What are some differences between the water, carbon , and nitrogen cycle ?​
    5·1 answer
  • What happens when heat from inside Earth is transferred to its surface?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!