1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks04 [339]
4 years ago
10

What is name for the point on the earth’s surface where the earthquake occurs?

Biology
2 answers:
Semenov [28]4 years ago
7 0
Answer: Epicenter

If it would be under the surface it would be called a hypocenter
lisabon 2012 [21]4 years ago
3 0

Answer:

Epicenter

Explanation:

The release of energy causes shaking at the ground surface. The location inside the Earth where an earthquake begins is called the focus (or hypocenter) of the earthquake. The point at the Earth's surface directly above the focus is called the epicenter of the earthquake.

You might be interested in
Which statement describes transform boundaries?
WARRIOR [948]
Transform boundaries are places where plates slide sideways past each other. At transform boundaries lithosphere is neither created nor destroyed. Many transform boundaries are found on the sea floor, where they connect segments of diverging mid-ocean ridges. California's San Andreas fault is a transform boundary.
3 0
3 years ago
Give the nucleotide positions of all single-nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in a sin
krek1111 [17]

Answer:

1st has A and G whereas 2nd has C and T.

Explanation:

There are three common haplotypes present in the population. The first single nucleotide polymorphism has A and G alleles while on the other hand, the second single nucleotide polymorphism has C and T alleles. The four possible combinations of haplotypes for the above two single nucleotide polymorphisms are AC, AT, GC, and GT.

7 0
3 years ago
Why does surface tension occur?
Kisachek [45]
Surface tension in water owes to the fact that water molecules attract one another, as each molecule forms a bond with the ones in its vicinity. ... This inward net force causes the molecules on the surface to contract and to resist being stretched or broken.
6 0
3 years ago
Label the components of the activation of a helper t cell by a dendritic cell.
ira [324]

T cell receptor, Cytotoxic T Cell, CD4, Antigen, Bacterium, B – cell, Cell mediated response, Class II MHC, Cytokines, and Humoral Response are the components for the activation of a helper t cell by a dendritic cell.

8 0
3 years ago
In the Indian painting featuring the Mughal Emperor Babur in his garden ( 1.8.9), the garden is punctuated by a specific feature
kupik [55]

Answer:

Water

Explanation:

6 0
3 years ago
Other questions:
  • How are tumor cells different from normal cells?
    7·1 answer
  • Describe at least two ways bone functions in protection of the human body.
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Treatment of a decubitus ulcer may include the application of gelatin sponges, granulated sugar, karaya gum patches, or debridin
    5·1 answer
  • Which of the statements about the relationship between DNA technology and genetic diversity is accurate? a.DNA technology can re
    7·2 answers
  • Post Test
    13·1 answer
  • What do you think would happen to the population of rabbits, if the population of foxes decreased?
    13·2 answers
  • PLEASE HELP! WILL MARK BRANLIEST!
    15·1 answer
  • Which three processes occur during meiosis?
    12·2 answers
  • Scientific argumentation can be a pathway to_____
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!