1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
3 years ago
5

A group of students is setting up a test to see whether earthworms like those shown in the photo prefer rough or smooth surface

which type of investigation is the group A group of students is setting up a test to see whether earthworms like those shown in the photo prefer rough or smooth surface which type of investigation is the group doing
Biology
1 answer:
Sladkaya [172]3 years ago
5 0

Answer:

There is no attached photo in this question, however, the question can still be answered. The question also lacks options; they are

A.Comparative B. Descriptive. C. Controlled. D. Experimental

The answer is D. Experimental investigation

Explanation:

There are three types of investigations in science namely: descriptive, comparative, and experimental investigations. Experimental investigations are those investigations that has to do with the testing of how one variable affects another.

In an experimental investigation, a variable called INDEPENDENT VARIABLE is changed to effect a response in another variable called DEPENDENT VARIABLE. In this question, a group of students is testing to see if earthworms prefer rough or smooth surface. Hence, they are testing to see how texture of a surface (rough or smooth), which is the independent variable affects the preference of earthworm. Hence, it is an EXPERIMENTAL VARIABLE.

You might be interested in
How do you really know when something is alive? What's your test for deciding if something is alive? How would explain your defi
tia_tia [17]
Something breathing.
7 0
3 years ago
Provides energy in the form of atp endoplasmic reticulum (er) for a storage reservoir and transport channel within the cell?
almond37 [142]
<span>This form of providing energy for the storage and transport within the cell is called as Mitochondria. The energy production is done threw respiration and help regulate the cellular metabolism. Mitochondria are organelle that is present in the cytoplasm, not nucleus. Exercising your body can boost the density of mitochondria.</span>
6 0
4 years ago
Which substance is used by plants as a source of food?
seraphim [82]

Answer:

Glucose

Explanation:

3 0
3 years ago
Read 2 more answers
The largest molecules in organisms are _____.
kiruha [24]
It is Nucleic Acids, they consist of long chains of units like the proteins, but still both are different.
6 0
3 years ago
In guinea pigs hair straightness or curliness is thought to be governed by a single pair of alleles showing incomplete dominance
Nimfa-mama [501]

Answer:

Frequency of allele S is p = 0.4939

Frequency of allele C is q = 0.666

The population is not in Hardy-Weinberg equilibrium

Explanation:

Given -

Number of individuals with straight hair = 244

Number of individuals with curly hair = 444

Number of individuals with Wavy hair = 312

Let "p" represents the frequency for allele for straight hair and "q" represents the frequency for allele for curly hair

p^2 represents the frequency of genotype "SS"

p^{2} = \frac{244}{1000} \\= 0.244

q^2 represents the frequency of genotype "CC"

p^{2} = \frac{444}{1000} \\= 0.444

2pq represents the frequency of genotype "SC"

2pq = \frac{312}{1000} \\= 0.312

Frequency of allele S is p

= \sqrt{0.244} \\= 0.4939

Frequency of allele C is q

tex]= \sqrt{0.444} \\= 0.666[/tex]

For being in Hardy Weinberg's equation-

p+q=1\\

Substituting the values in above equation, we get -

0.4939+0.666\neq 1

hence, the population is not in Hardy-Weinberg equilibrium

4 0
4 years ago
Other questions:
  • Can you cry underwater?
    15·1 answer
  • The atmosphere contains about 78 percent oxygen true or false
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The Cell theory states that the cell is the basic unit of life, while the Organismal Theory states that the organism is the basi
    6·2 answers
  • __________, harmful or helpful is considered to be the source for new alleles and a main contributor to the diversity of life.
    11·2 answers
  • 1. If there is not enough carbohydrate intake, how does the body form glucose?
    10·1 answer
  • The 31 major nerves that branch out from the spinal cord connecting it to the rest of the body are the
    6·1 answer
  • Invasive species are one of the major threats to blodiversity. These species multiply quickly and compete with native species fo
    6·1 answer
  • The Earth remained a frozen snow ball until carbon dioxide levels in the atmosphere increased. Why did carbon dioxide from the v
    9·1 answer
  • Bad weather is normally associated with_.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!