1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
4 years ago
13

The Coriolis effect contributes to ________.

Biology
1 answer:
KIM [24]4 years ago
8 0
The answer is e. global wind patterns
You might be interested in
20 POINTS! Why is it important to use a controlled experiment?
gregori [183]
Answer is B !!!

you have to know what youre doing
3 0
2 years ago
Read 2 more answers
The ions in highest concentration in the intracellular fluid are
sammy [17]
Intracellular fluid (ICF) is found only within blood vessels.
8 0
3 years ago
How are sex-linked traits inherited?
blsea [12.9K]

Answer;

Alleles are passed from the parents’ sex chromosomes to the sex chromosomes in the offspring.


Explanation;

-Sex linked traits are traits that are carried by the sex chromosomes and inherited together.

-Gene exists in alternative forms called alleles and each allele for a trait is inherited from each parent.

-Sex traits, like the other traits, are passed from parents to off spring through the process of sexual reproduction.

3 0
3 years ago
Read 2 more answers
What are the different levels of organization of a muscle down to myofilaments
Usimov [2.4K]

Answer:

Molecular, Microscopic, Cell, Tissue and Organ levels

Explanation:

The natural strength production needed for skeletal muscle to function occurs at the molecular level. You can develop a better knowledge of the properties of cells and tissues by simply studying the molecular systems common to the cells in question. The different muscular level down to myofilaments are:

  • Molecular level — actin and myosin
  • Microscopic level — sarcomere and myofibrils
  • Cell level — myoblasts and myofibers
  • Tissue level — neuromuscular intersections and fascicles
  • Organ level — The key skeletal muscles of the body
8 0
4 years ago
Read 2 more answers
Question
neonofarm [45]

Answer:

  • <em><u>color of light, then white light will produce the tallest plant."</u></em>
  • Explanation:
<h2>Identify at least four controls in the experiment and give a possible example for each - Create a realistic way to test the hypothesis - Indicate a way to record data - Create a realistic conclusion based on your test</h2>

7 0
2 years ago
Other questions:
  • What does it mean that humans are coded?
    12·1 answer
  • What is most likely to happen to an abandoned strip mine over time?
    10·2 answers
  • Why do scientists use taxonomy to classify organisms
    6·1 answer
  • During which period did eurypterids swim the oceans and the first jawed fish and vascular plants evolve?
    10·2 answers
  • What does a materials scientist do?
    10·1 answer
  • The part of an enzyme that binds to the substrate is
    10·2 answers
  • The importance of caring and irrigation in fruit farming?​
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which of the following statements concering scientific hypotheses is fake?
    10·1 answer
  • What phylum are cats in.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!