1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
2 years ago
15

What is the genotype at the Q gene?

Biology
1 answer:
jenyasd209 [6]2 years ago
5 0
The genotype of the Q gene is homozygous dominant because it has 2 dominant genes and when a genotypes has two of the same type of genes it is homozygous. If it has different genes it is heterozygous. 

hopefully this helps

You might be interested in
What is the basic unit of classification of living beings​
SpyIntel [72]

Answer:

The basic unit of classification of living beings, from the taxonomic point of view, is species.

Explanation:

Taxonomy is a discipline that deals with the classification of living beings, its basic unit of classification being the species category.

<u>A species includes all the individuals with morphological and functional similarities</u>, which also have the capacity to make crosses among them and have a descendant with the same characteristics, including fertility.

6 0
2 years ago
If Mr. Dorji is conducting an experiment to determine the rate of photosynthesis in the presence of varing degrees of light inte
qwelly [4]

Answer:

Independent: Light intensity

Dependent: Rate of photosynthesis

Explanation:

The independent variable is the variable that changes, to determine if it has an effect on something.

The dependent variable is the variable that's measured.

Hope this helps!!

8 0
2 years ago
What is the main difference between renewable and nonrenewable resources
Julli [10]
<span>The main difference of renewable and non-renewable resources lies in the capacity of the environment to replenish itself. Renewable resources are resources that can be easily replenished by the environment over a short period of time, while non-renewable resources take more time. <span>

Examples of renewable resources are solar energy, harnessing the sun's power that shines day to day. Wind energy that exists naturally is also a renewable source. Geothermal energy, heat coming from the center of the Earth, and Biofuels, fuels made from living organisms, are all renewable energy. 

<span>Non-renewable energy resources are the fuels we use in our cars, minerals from the soil, coal, among others are supplies that also come from Earth. These are all materials that might take a long time (probably millions of years) to be fully restored. </span>


</span></span>
4 0
3 years ago
Read 2 more answers
Why is important for scientists to remain open minded about information they come across in their experiments
Lina20 [59]
It is important for scientists to remain open minded about information that they come across in their experiments, so that they do not become biased about the result. it can always happen that the results that come out are contrary to what the scientist expected. It is important to openly accept that the scientists prediction was wrong.
8 0
3 years ago
What might happen if you lose a lot of your platelets?
lianna [129]
Blood platelets... I think are red blood cells, I know we have red and white... hmmm... hope that helps
4 0
3 years ago
Read 2 more answers
Other questions:
  • Unlike most mites, termites can digest wood. This ability comes from protozoa that live in the a termite’s digestive tract. Thes
    5·1 answer
  • List the common levels of modern classification from general to specific
    9·1 answer
  • What role does the endomembrane play
    9·1 answer
  • Which part of the brain contains the client's "central switchboard" of the central nervous system?
    7·1 answer
  • Whats the reactant gas in the aerobic respiration equation?
    8·2 answers
  • What distance was used to define the astronomical unit (AU)?
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • To “think like a biologist” means ______ because _______.
    10·1 answer
  • PLEASE ANSWER FAST!!!
    7·2 answers
  • What happens first when a bladderwort catches a
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!