1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
8

Chlorophyll is a green pigment that absorbs ____ and ______ light the best.

Biology
1 answer:
pashok25 [27]3 years ago
8 0

blue-violet (chlorophyll a) & red (chlorophyll b). that's why it appears to be green.

You might be interested in
What does sustainability mean? please give examples too
satela [25.4K]
Hi there!

Sustainability means that something or someone has the ability to keep something going. 

For example, a plant could have good life sustainability because it has a special poison, keeping predators away from it.

You could be self sustainable by growing your own crops, collecting your own water, and making things you need.

Hope this helps!
5 0
3 years ago
Read 2 more answers
What is not a name for a chain of amino acids
lana66690 [7]

Answer:

are there options?

Explanation:

5 0
3 years ago
What do we mean when we say that the genetic code is degenerate?A single codon can encode more than one amino acid.An amino acid
Arada [10]

Answer:

An amino acid can be encoded by more than one codon.

Explanation:

Codons are triplets of nucleotides in mRNA that are used for the protein synthesis (translation). A codon specifies a single amino acid, but there are exceptions. tRNA molecule contain anticodons, triplets of nucleotides that are complementary to codons. So, during the translation, tRNA carries the amino acid, that corresponds to the codon in mRNA.

Degenerate genetic code (more than one codon can code for the same amino acid) is important, because when point mutation occurs it is possible that the amino acid remains unchanged.

8 0
3 years ago
What electrons are used to form iconic and covalent bonds
Sever21 [200]

Answer:

Valence electrons, or the electrons that are farthest from the nucleus.

5 0
3 years ago
Traits that are sex-linked are carried on_____
mestny [16]

x or y because both can cause it

4 0
3 years ago
Other questions:
  • The first man-made satellite, Sputnik 1, was launched into space in 1957. This satellite was used to study the conditions found
    12·2 answers
  • What is the term used to describe the energy needed to get a reaction started?
    9·1 answer
  • Which best defines what matter is? A)anything that can be weighed B)anything that takes up space C)anything that can be weighed
    15·2 answers
  • Sieve tube members better conduct sucrose by ______.
    15·1 answer
  • Which of the following glands is found in the abdomen?
    11·2 answers
  • Which of the following is an example of liverwort?<br> Sphagnum<br> Marchantia<br> Fontinalis
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Scientists can bioengineer skin in a laboratory to treat severe burns and other types of skin injuries. This bioengineered tissu
    8·1 answer
  • Astronomy is the study of the ___ beyond earth.
    15·1 answer
  • 1. why are pyruvates converted into acetyl-coa prior to entering the krebs cycle? what does this conversion do to the pyruvate m
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!