1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
9

A variety of opium poppy (Papaver somniferum L.) having lacerated leaves was crossed with a variety that has normal leaves. All

the F1 had lacerated leaves. Two F1 plants were interbred to produce the F2. Of the F2, 249 had lacerated leaves and 16 had normal leaves. Give genotypes for all the plants in the F1, and F2 generations. Explain how lacerate leaves are determined in the opium poppy. (Section 5.2)
Biology
1 answer:
Ainat [17]3 years ago
5 0

Answer:

The correct answer is-

F1 -  AaBb (lacerate)

F2 - A_B_; A_bb; and aaB_ (lacerate)

     - aabb (normal)

2. Two genes, with a dominant allele at either or both loci.

Explanation:

The given information gives THE following data:

Dominant: Lancerate leaves - AABB

Recessive: normal leaves - aabb

F1 has - all Lacerated leaves - AaBb

F2 by selfing F1:

         AB               Ab         aB         ab

AB    AABB        AABb      AaBB    AaBb

Ab     AABb       AAbb      AaBb     Aabb

aB     AaBB       AaBb       aaBB     aaBb

ab     AaBb       Aabb       aaBb      aabb

Here, 15/16 = lacerate which is 0.94 which is equal to the value of lacerate given in the question - 249/265 = 0.94

And normal 1/16 = 0.062 is almost same as 16/265 = 0.060

Thus, the genotypes of -

F1 -  AaBb (lacerate)

F2 - A_B_; A_bb; and aaB_ (lacerate)

     - aabb (normal)

You might be interested in
The global environment,
worty [1.4K]
What do you mean global environment
5 0
3 years ago
The graph shows the percentage of dog breeds affected by elbow dysplasia, which causes dogs to limp. What’s the most likely expl
Sedbober [7]

A - has a low diversity of genes therefore they are having issues w the breed not becoming strong but instead weaker

7 0
3 years ago
Which contains the greatest variety of cell types
daser333 [38]

Answer:

multicellular

Explanation:

7 0
3 years ago
Someone please help me
umka2103 [35]

Answer:

mass and volume

Explanation:

Matter is anything that has mass and takes up space

8 0
3 years ago
Read 2 more answers
Replication is when DNA is?<br> O Mutated<br> O Changed<br> O Copied<br> O Destroyed
Karolina [17]
Copied, I agree with the person above ^ :’)
4 0
3 years ago
Other questions:
  • The type of society that has the greatest energy needs is the
    11·1 answer
  • Please help!!!
    5·1 answer
  • Which is a function of nucleic acids?
    13·1 answer
  • Which biological macromolecule is the most important and why
    7·1 answer
  • Classification is an important aspect of understanding and describing the many life forms on earth. In their classification sche
    8·1 answer
  • Cell division typically yields two daughter cells, each with one nucleus. How is the occasional binucleate condition of liver ce
    12·1 answer
  • Question 3 of 10<br> How is a scientific theory developed?
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Top layer of the leaf that serves as waterproof covering is the​
    5·1 answer
  • In which situation is energy released by a plant?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!