1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ollegr [7]
3 years ago
15

What are thebacteria called that requires a constant supply of oxygen in order to survive

Biology
1 answer:
andrezito [222]3 years ago
8 0

Obligate aerobes Is what I believe the answer would be.




You might be interested in
In the analogy of a cell as a school,
prisoha [69]

Explanation:

In the analogy of a cell as a school, lysosomes could be thought of as a teacher.

Because teacher helps students by solving complex problems in simple way and as teacher lysosomes also helps us by breaking down the complex thing in the cell.

5 0
3 years ago
Read 2 more answers
Describe the relationship between an action spectrum and an absorption spectrum. Explain why the action spectrum for photosynthe
Marina86 [1]

Answer:

An absorption spectrum illustrates the spectrum of light or electromagnetic radiation absorbed by the plant. This relies upon the molecular and cellular build-up of the plant. An action spectrum illustrates the spectrum of electromagnetic radiation most efficient for photosynthesis.  

The action spectrum of photosynthesis monitors the absorption spectrum of chlorophyll. The absorption spectrum suggests that how much of each wavelength chlorophyll will captivate, while the action potential can indicate to us about the wavelengths that are most operative for photosynthesis.  

8 0
2 years ago
Which of the following statements about apoptosis is false? a. It is an important process in the development of human fingers an
spin [16.1K]

Answer:

C) Because apoptosis genes kill cells, natural selection is seldom involved in apoptosis pathways.

Explanation:

Apoptosis is a natural process taking in the cell which causes the physiological and biochemical changes in the cell which could cause the death of the cell.

The apoptosis is controlled at the genetic level therefore apoptosis is also known as the programmed cell death.

The studies have shown that the process is involved in the development of the finger and the toes in humans and the sequences controlling the process has been conserved during the evolution in a different organism.

This shows that humans and nematode have the same conserved sequence of apoptosis but the natural selection does not control the apoptosis.

Thus, the selected option is the correct answer.

5 0
2 years ago
Please help me answer this!!!
Xelga [282]

Answer:

Brain

Explanation:

The brain has nerve endings that responds to stimulations such as sensory stimulations

7 0
2 years ago
Wohler and Kolbe demonstrated that organic compounds, such as urea and acetic acid, could be synthesize from:
ElenaW [278]
I think the answer you’re looking for is
D. Carbon, hydrogen, and oxygen
-I hope this helps! Enjoy the rest of your day
4 0
3 years ago
Other questions:
  • Which is not true regarding the spleen?
    6·1 answer
  • Which statement best describes what happened when Constantine tried to establish "New Rome"?
    5·1 answer
  • What is the repeating subunit of starch?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Glaciers pick up large rocks and carry them away. This is called _____.
    6·2 answers
  • Which statement describes a similarity between asexual reproduction and sexual reproduction?
    11·1 answer
  • A beaker of distilled water was placed on a bench. Using a pipette a drop of red blood cells was placed at the bottom of the bea
    13·1 answer
  • Equation of photosynthesis
    10·1 answer
  • Bacteria cells reproduce by binary fission, a type of asexual cell division. One evolutionary advantage of binary fission is ___
    10·2 answers
  • Suppose a new island is discovered with previously unknown species and we need to figure out what it was. What lines of evidence
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!