Answer: c.animals
Explanation:
A biosphere in geology can be define as the part of the earth atmosphere and other regions typically including landforms such as mountains, deserts, forests and oceans which gives a habitat for the survival of survival of living beings.
Animals is the correct option because they cannot become a substrate for the survival of the living beings directly.
The word transcribe means 'to pass the code from DNA to RNA', whereas the word translate means 'change from mRNA to protein', which is a different language.
<h3>What is the genetic code?</h3>
The genetic code is a series of instructions that indicate how to synthesize proteins from a given gene sequence.
During transcription, the DNA gene sequence is transcribed into a messenger RNA (mRNA).
During translation, triplets of nucleotides or codons in mRNA determine specific amino acids in the growing protein sequence.
In conclusion, the word transcribe means 'to pass the code from DNA to RNA', whereas the word translate means 'change from mRNA to protein', which is a different language.
Learn more about transcription and translation here:
brainly.com/question/25703686
#SPJ1
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Earth climate has a lot to do with weathering of rocks. When the temperature is high, there is more weathering of rocks, when the temperature is low, weathering of rocks is less.
<u>Explanation:</u>
Studying the rocks which is the field of Geology is done to study about the minerals, and other useful substances which tells a lot about the climate of the planet Earth.
The increase in the weathering of the rocks tells about the high temperature of the planet Earth. In the previous times, when there was less of carbon dioxide in the atmosphere, the temperature used to be low, there was less weathering of the rocks.
They can produce 3 types of gametes; gggg, ggtt and tttt in the ratio of 1:2:1. As shown in the table attached, the tetraploid parents produce diploid gametes that combine to form genetically varied offspring.
The genotypes may differ from that of the genotype depending on the interaction of the dominant, recessive and codominant alleles.
