1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrej [43]
4 years ago
15

Cells need ___ for energy ATP is used as ___.

Biology
1 answer:
stich3 [128]4 years ago
3 0
First blank is glucose and the second blank is energy storages
You might be interested in
How are bacteria, a rose, and an elephant alike?
nevsk [136]
They are all living organisms
6 0
3 years ago
Read 2 more answers
A gene is considered to be non-Mendelian in its inheritance pattern if it seems to "violate" Mendel's laws. Which of the followi
myrzilka [38]

Answer:

A gene transmitted to males from the maternal line and from fathers to daughters.

Explanation:

Gregor Mendel through his research on pea plants, came up with three laws which are:

  1. <em> The Law of Segregation of genes: Each inherited trait is defined by a pair of  gene alleles. Genes are randomly separated to the sex cells so that sex cells contain only one allele of the pair.  </em>
  2. <em>The Law of Dominance: An organism with alternate forms of a gene will express the form that is dominant. </em>
  3. <em>The Law of Independent Assortment: Genes for different traits are sorted separately from one another so that the inheritance of one trait is not dependent on the inheritance of another. </em>

<em></em>

In His work, he established the basic patterns of inheritance and it wasn't until after his death that sex linked inheritance patterns were identified.

He believed that a pair of genes called alleles, were transmitted, each allele from one parent and both alleles transmitted from each parent constituted the complete pair in the offspring.

However, if different variants of the same gene were inherited from both parents, the dominant gene is expressed in the offspring (phenotype).

Since the basis of his work established genes being equally transmitted by both parents to offspring, the variations being due to dominance, genes transmitted from mother to son and from father to daughter, follows the Mendelian pattern of inheritance.

4 0
3 years ago
Which class of<br> macromolecules does DNA<br> and RNA belong?
agasfer [191]

Answer:

Nucleic acids

Explanation:

Nucleic acids, macromolecules made out of units called nucleotides, come in two naturally occurring varieties: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

i hope this helps:)

8 0
3 years ago
Read 2 more answers
1. Write a paragraph of 3-5 sentences to answer the following question. Your answer should demonstrate an understanding of the i
nignag [31]

Answer:

When you sit on a plane for 6 hours without moving, blood accumulates in your veins, and the moment you get up, gravitational forces affect venous return, cardiac output, blood pressure, and venous pressure. That way, when you're sitting on a plane, the gravitational force is the same at the upper and lower extremities, such as the chest, abdomen, and legs, causing venous blood pressure and volume to be evenly distributed throughout the body. However, when one gets up, one becomes dizzy because of abnormal regulation of blood pressure. This is because gravity causes blood to accumulate in the lower extremities (veins of the legs and trunk). This lowers the blood pressure and the blood that the heart pumps. By causing blood to accumulate in the lower extremities, and as venous compliance increases, the veins expand with blood that causes the volume of blood to shift in the veins. This increases the volume and venous pressure in the lower extremities when standing. And the volume of thoracic venous blood is less and less central venous pressure. This leads to a decline in stroke volume. Cardiac output and mean arterial pressure also decrease as left ventricular stroke volume decreases, reducing pulmonary venous return. Decreased standing blood pressure, referred to as orthostatic or postural hypotension. Thus, lowering blood pressure decreases cerebral blood flow, which means less range of blood in the brain causing dizziness.

Explanation:

6 0
4 years ago
I need help pleaseeee
mariarad [96]

Answer:

D

Explanation:

That’s the one that’s most specific. That one tells you about the mosquito it’s self and your part of US not US in general.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Sound waves with a large distance between A and B would be sound waves that have a large ________ and produce loud sounds.
    11·2 answers
  • You are on standby at a sporting event when an infant nearby suddenly begins to cough
    13·1 answer
  • Is it true that bases are bitter and slippery
    15·1 answer
  • The pattern of the ocean rising and falling due to the gravitational pull of the moon
    12·2 answers
  • Which gas giants have a ring system? Select all that apply.
    12·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • To calculate the speed of wave, what two pieces of information do you need about the wave ?
    14·1 answer
  • The biome immediately south of the Taiga is the ______.
    8·1 answer
  • What is the answer i need it fast
    8·1 answer
  • Pioneer organisms are the first organisms to reoccupy an area, which has been disturbed by a disruption. Typical pioneers in a s
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!