Answer:
Economic growth
Explanation:
It would help the planet plants animals and people
Answer:
e. cutin
Explanation:
Plant exhibit many variations to withstand the temperature variations, desiccation and increased UV exposure which are some of the factors associated with land habitat. Cutin is a waxy substance that is found in the outer walls of the epidermal cells of plants. Cuticle in plants serves to make the outer most covering of aerial parts of the leaves and non-woody stem of herbaceous plants. The cuticle is made of cutin.
Cutin serves to protect the plant’s aerial surfaces from excess water loss. It also filters the excess UV light and thereby protects the underlying plant parts. The thickness of the cuticle varies in different plants depending upon the environmental conditions. The leaves of plants adapted to hot, dry climates have thick cuticles. The thickness of the cutin layer also varies in different parts of a plant. For example, the upper epidermis of leaf generally has a thicker cuticle than the shaded and relatively cooler lower epidermis.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer: Mitosis
Explanation:
Mitosis is one of the two types of cell division alongside meiosis. All the cells in the body undergo mitosis except sex cells such as male sperm and female ova that undergoes meiosis during sexual reproduction.
Thus, since mitosis occur in body cells, most of the cells in humans are body by it.
