1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
3 years ago
10

Which describes the process of a bacterial cell dividing to create two daughter cells?

Biology
2 answers:
andriy [413]3 years ago
8 0
Binary Fission i believe is the answer have a very nice day
k0ka [10]3 years ago
4 0

<span>I believe it's "binary fission"
 </span>
You might be interested in
How do land plants generate the energy they need for their metabolic energy?.
Dmitry_Shevchenko [17]

Answer:

Multiple ecosystems get their energy in the form of sunlight, which make its way through the ecosystem through photosynthesis.

4 0
3 years ago
Why did we make sure to include a start and stop dna sequences for the jellyfish?
katrin [286]
We did  make sure to include a start and stop dna sequences for the jellyfish so that  the Glo gene would be transcribed and expressed and so we can see that we have successfully transformed the cells into which we place the engineered <span>plasmid.</span>
8 0
4 years ago
Read 2 more answers
Hi, i need help, my brain can’t think probably:D
HACTEHA [7]

Answer:  

1.  Angiosperms develop unique reproductive organs known as flowers. Flowers contain ovaries, witch surround and protect the seeds.

2. The main parts of a flower are the sepals and petals, which protect the reproductive parts: the stamens and the carpels. The stamens produce the male gametes in pollen grains. The carpels contain the female gametes (the eggs inside the ovules), which are within the ovary of a carpel.

3. All angiosperms have flowers at some stage in their life. ...

Angiosperms have small pollen grains that spread genetic information from flower to flower. ...

All angiosperms have stamens. ...

Angiosperms have much smaller female reproductive parts than non-flowering plants, allowing them to produce seeds more quickly.

4. When an individual organism increases in size via cell multiplication and remains intact, the process is called "vegetative growth". However, in vegetative reproduction, the new plants that result are new individuals in almost every respect except genetic.

5. Fruits are produced only by flowering plants (angiosperms). Following pollination of the flower, the fertilized ovules develop into seeds while the surrounding ovary wall forms the fruit tissue, or pericarp.

Explanation:

8 0
3 years ago
Pet owners have abandoned their Burmese pythons in the Everglades. Native species of frogs and reptiles decrease with the introd
Len [333]
It would be a loss in biodiversity , due to invasive species because the abandonment of pythons grew and they bred and had babies
8 0
3 years ago
Read 2 more answers
What is the term for a water wave that is created by an underwater earthquake
Slav-nsk [51]

A Tsunami

Tsunamis are very long waves that can reach up to very big heights

The biggest tsunami ever was 1720 feet tall

8 0
3 years ago
Read 2 more answers
Other questions:
  • When water flows from a faucet, the water molecules
    12·1 answer
  • the field of this microscope is brightly illuminated and used for most microscopic work. a. bright field microscope b. electron
    11·1 answer
  • Why is tissue typing necessary before a kidney transplant?
    13·2 answers
  • List three organisms which cause crop disease​
    14·1 answer
  • The autonomic nervous system controls skeletal muscle? True or false.
    14·1 answer
  • which disorder is degenerative and caused in part by a deficiency of the neurotranmitter acetylcholine?​
    9·1 answer
  • How can several different mutations cause the same genetic disease?
    5·1 answer
  • Different seedless plants are grouped based on which characteristic
    11·1 answer
  • Which activity can be accomplished using the genetic code?
    6·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!