1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
5

Is it true or false

Biology
2 answers:
trapecia [35]3 years ago
8 0
False it is actually the 5th most abundant element in the universe 
Sonbull [250]3 years ago
6 0
False is the correct answer 

You might be interested in
Which two pieces of fossil evidence support the idea of continental drift?
In-s [12.5K]
The answer should be a
5 0
3 years ago
PLEASE I NEED HELP WITH THIS SCIENCE HOMEWORK WILL GIVE BRAINLIEST
olga55 [171]

Answer:

1. Nucleus

2. Nuclear DNA

3. Chromosomes. They contain the DNA.

4. This is DNA. DNA contains the instructions needed for an organism to develop, survive and reproduce.

5 0
3 years ago
Read 2 more answers
What are those characteristics of a psychological test?​
poizon [28]
Objectivity: The test should be free from subjective—judgement regarding the ability, skill, knowledge, trait or potentiality to be measured and evaluated. 2. Reliability: This refers to the extent to which they obtained results are consistent or reliable.


Can I have brain list pleaseeee
6 0
2 years ago
What is a derived trait?
Agata [3.3K]

Answer:

A.

Explanation:

Because the trait undergoes a secondary loss; it has been there but it doesn't always appear in all generations.

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Why are compounds different from single elements?
    7·1 answer
  • Why is photosynthesis important to both producers and consumers?
    14·1 answer
  • What was the source of the microscopic "animalcules" described by Leeuwenhoek?
    14·1 answer
  • *Will Give Brainliest* Please put the steps of the process an oxygen molecule goes through to get from the outside to the blood
    13·1 answer
  • Organisms, like bacteria or lichen, that can live on bare rock and form soil are called
    9·1 answer
  • Which of the following statements are False?
    12·1 answer
  • Which of the following climates is a high-latitude climate?
    6·1 answer
  • Which set of features below best describes the radiolaria?
    13·1 answer
  • A woman who is a carrier for XLA marries a man who does not have the disorder. They have four sons. How many could be expected t
    5·1 answer
  • Someone help pleaseee easy 7th grade work
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!