Answer:
1. Nucleus
2. Nuclear DNA
3. Chromosomes. They contain the DNA.
4. This is DNA. DNA contains the instructions needed for an organism to develop, survive and reproduce.
Objectivity: The test should be free from subjective—judgement regarding the ability, skill, knowledge, trait or potentiality to be measured and evaluated. 2. Reliability: This refers to the extent to which they obtained results are consistent or reliable.
Can I have brain list pleaseeee
Answer:
A.
Explanation:
Because the trait undergoes a secondary loss; it has been there but it doesn't always appear in all generations.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.