1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
2 years ago
14

Which process produces carbon dioxide?

Biology
2 answers:
Ad libitum [116K]2 years ago
7 0

Answer:

Cellular respiration

Explanation:

Evaporation is h20 = oxygen and hydrogen, precipitation is rain, photosynthesis produces oxygen

mel-nik [20]2 years ago
4 0

Answer: cellular respiration

Explanation:

In cellular respiration, glucose molecule is broken down in the presence of oxygen to form carbon dioxide and water. The equation for the reaction is C6H12O6 + 6O2 --> 6CO2 + 6H2O + Energy

In cellular respiration carbon dioxide and water are the byproducts, but in photosynthesis, glucose and oxygen are produced.

You might be interested in
An experiment to show thy chlorophyll is needed during photosynthesis
tester [92]
Energy from the sun heat and chemicals
6 0
3 years ago
Human movement behaviour
azamat

Answer: i really dont know

Explanation:

im sorry im just trying to get questions

8 0
3 years ago
How is neuron like and different from a blood cell
jok3333 [9.3K]

Answer:

Neurons are similar to other cells because neurons have a cell membrane, a nucleus, cytoplasm, mitochondria, organelles, and carry out processes such as energy production.

Neurons differ from other cells because neurons have extensions called axons and dendrites, they communicate with each other through an electrochemical process which we just talked about, and neurons have specialized structures such as synapses and chemicals such as neurotransmitters.

Explanation:

there you go

5 0
2 years ago
Finger like extensions of the amoebas cytoplasm are called?
KonstantinChe [14]

they are called
pseudopodia

hope it helped :)

7 0
3 years ago
Read 2 more answers
A conservation plan could proceed with a single 20-square kilometer habitat preserve or with two habitat preserves, measuring a
Aleksandr [31]

A conversational plan with two habitat preserves, measuring a total of 20 square kilometers combined will preserve more species because this cause segregation of species based on their adaptability towards a safer and secure environment. For example if a lion and deer try to live in the same conservation area, then it’s obvious that the life of deer is always at risk. But in cases of segregated preserved areas both herbivorous and carnivorous animals can live separately. Also if there is special inclination of one species towards other then also these two species can live separately.  

Segregation also enhances the diversity in the sense that it could lead to a new ecosystem with a new ecological balance within it. Conservation biologists focus on these areas as they claim that  where the greatest number of unique species can be found and protected with in the large number of reserve areas with the least amount of effort  


6 0
3 years ago
Read 2 more answers
Other questions:
  • This is the role of a species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
    14·2 answers
  • Which format should he use to present his data? bar graph chart line graph pie graph
    13·2 answers
  • A natural disaster produced by volcanic activity that has killed more people than lava flows is _____.
    5·2 answers
  • Somebody plz answer for this question
    9·1 answer
  • How is globalization potentially damaging to the environment?
    10·2 answers
  • Science is
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How are humans and plants alike in adjusting to changs in the environment?<br><br>​
    8·2 answers
  • Energy is stored in the body primarily as __________ in the muscles and liver and as ___________ in subcutaneous body fat.
    15·1 answer
  • 20x30 pls help worth 15 points
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!