1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
3 years ago
11

What kind of pollution is threatening some estuaries¿

Biology
1 answer:
WINSTONCH [101]3 years ago
4 0
Pathogens and run off from factories, oil spills and host of other poisons are threatening these places
You might be interested in
When is your respiration rate likely to change?
Taya2010 [7]

Answer:

I believe the answer is "C. When your cells need more oxygen."

Please mark brainliest, if right. Thanks :)

5 0
3 years ago
Read 2 more answers
What can you conclude about fossil by looking at the layers of rock?
Sergio [31]

Answer:

The fossils in the lower layers are older than the fossils in the upper layers.

Explanation:

8 0
3 years ago
Surface ocean currents are primarily formed by what?
Nina [5.8K]
It is formed by winds


hope this helps you! (:
7 0
3 years ago
Read 2 more answers
Which protist is considered to be the most complex and specialized?
Elis [28]

Answer:

The answer is B. Paramecium.

Explanation:

8 0
3 years ago
What happens during G1 phase?
vovangra [49]

Answer:

c.

Explanation:

the chromosomes are duplicated.

7 0
3 years ago
Other questions:
  • Which diagram best illustrates what happens when electromagnetic waves strike a reflective material? A horizontal red curved lin
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A preschooler's mother was exposed to cats during her pregnancy, and the child has toxoplasmosis. which influence on development
    10·1 answer
  • Explain how proteins and nucleic acids are different in function
    12·1 answer
  • The P plants (the parental generation) that Mendel used in his experiments were all homozygous for
    13·1 answer
  • Is black coffee an element compound or mixture
    8·1 answer
  • What is an educated guess posed as a tentative explanation called
    5·1 answer
  • The mantle is always solid. True or false?
    14·2 answers
  • Define and describe the human trafficking
    10·2 answers
  • Select and predict in the case of the drought in the deer habitat in question 3, select a density-dependent factor and predict w
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!